ID: 1003129946

View in Genome Browser
Species Human (GRCh38)
Location 6:3386838-3386860
Sequence AACAAGGACTTGCTTCCACA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1003129943_1003129946 -5 Left 1003129943 6:3386820-3386842 CCTGGCAGCAACATGGGGAACAA 0: 1
1: 0
2: 1
3: 13
4: 165
Right 1003129946 6:3386838-3386860 AACAAGGACTTGCTTCCACAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1003129946 Original CRISPR AACAAGGACTTGCTTCCACA GGG Intronic
No off target data available for this crispr