ID: 1003131031

View in Genome Browser
Species Human (GRCh38)
Location 6:3395408-3395430
Sequence GCTGATCTTTACAAGATGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 148
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 136}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1003131031_1003131034 9 Left 1003131031 6:3395408-3395430 CCATCCATCTTGTAAAGATCAGC 0: 1
1: 0
2: 0
3: 11
4: 136
Right 1003131034 6:3395440-3395462 AAGAAGAGTAATAGGAAAACAGG 0: 1
1: 0
2: 5
3: 43
4: 825
1003131031_1003131033 1 Left 1003131031 6:3395408-3395430 CCATCCATCTTGTAAAGATCAGC 0: 1
1: 0
2: 0
3: 11
4: 136
Right 1003131033 6:3395432-3395454 TCATTAGCAAGAAGAGTAATAGG 0: 1
1: 0
2: 0
3: 11
4: 200

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1003131031 Original CRISPR GCTGATCTTTACAAGATGGA TGG (reversed) Intronic
901312667 1:8281583-8281605 GCACCTCTTTACAAGGTGGAAGG - Intergenic
902459326 1:16560909-16560931 GCTGAAATTCCCAAGATGGAAGG - Intergenic
903152521 1:21421590-21421612 GCTGAAATTCCCAAGATGGAAGG - Intergenic
903160610 1:21486395-21486417 GCTGAAATTCCCAAGATGGAAGG + Intergenic
903189361 1:21648166-21648188 GCCGATCTTTACTTGATAGACGG + Intronic
904556033 1:31365120-31365142 TCTGATCATTACAAAAGGGAGGG - Intergenic
909801912 1:79820583-79820605 TGTGATATTTAGAAGATGGAGGG + Intergenic
910207858 1:84765555-84765577 GCATTTCTTTACCAGATGGATGG + Intergenic
912569958 1:110614109-110614131 GCTGATCTCTGCAAGGTGCAGGG - Intronic
913606263 1:120469249-120469271 GCTGAAATTCCCAAGATGGAAGG + Intergenic
914210173 1:145570900-145570922 GCTGAAATTCCCAAGATGGAAGG - Intergenic
914269090 1:146063266-146063288 GCTGAAATTCCCAAGATGGAAGG - Intergenic
914368007 1:146997600-146997622 GCTGAAATTCCCAAGATGGAAGG + Intergenic
914484973 1:148100606-148100628 GCTGAAATTCCCAAGATGGAAGG - Intergenic
914584937 1:149052593-149052615 GCTGAAATTCCCAAGATGGAAGG - Intergenic
920362546 1:205429338-205429360 GCTGATCTTATCATGATGGTAGG + Intronic
1072305554 10:94103261-94103283 GCTTATTTTTACAAGATAAATGG + Intronic
1073637434 10:105214225-105214247 GCTACTCTTACCAAGATGGAGGG + Intronic
1076864571 10:133160492-133160514 GCGGATCTTTACGAGGAGGACGG + Exonic
1077100854 11:821700-821722 GATGATCTTTACCAGGTTGAAGG - Exonic
1078447379 11:11414522-11414544 TCTGAGCTTTAAAGGATGGAAGG - Intronic
1078677884 11:13442419-13442441 TCTGCTATTTACAAGTTGGATGG + Intronic
1079581625 11:22071558-22071580 GCTGGTCTTCACAAGGTGGCAGG + Intergenic
1080770730 11:35338908-35338930 ACTGAGCTTTTCAAGATGAAGGG + Intronic
1084205246 11:67587491-67587513 GCACATCTTTACAAGGTGGCAGG - Intergenic
1087389194 11:97513011-97513033 CCTGATCTTTGCTAGATGTATGG - Intergenic
1089508384 11:118979949-118979971 GCTGATCTTCAGAGGATGGTGGG - Intronic
1089918187 11:122180175-122180197 GATGAATTTTACAAGAAGGATGG + Intergenic
1090261742 11:125326278-125326300 GCTGGTCTTTGCAGGTTGGATGG + Intronic
1093977354 12:25437869-25437891 ACTGGTCTTTCCAGGATGGAAGG + Intronic
1094471734 12:30807860-30807882 ACTGATCTTAATAAGATGGCAGG + Intergenic
1095448672 12:42306756-42306778 GCACATCTTTGCAAGATGCATGG - Intronic
1097693370 12:62754938-62754960 TGTTATCTTTACAAGATGGGTGG + Intronic
1097708024 12:62888234-62888256 GCTGAAATTTATAAAATGGAGGG + Intronic
1100343187 12:93701206-93701228 AGTGATTTTAACAAGATGGAAGG + Intronic
1100376639 12:94022595-94022617 GCTGCTATTTGCCAGATGGAAGG + Intergenic
1102823926 12:115930794-115930816 GCTGATCTTTTCACATTGGATGG + Intergenic
1103368350 12:120399442-120399464 GCTGATCTTTTCAAGGGGGTGGG - Intergenic
1107028497 13:35827218-35827240 GCTTGTTTTTACAAGATGGCTGG + Intronic
1107756924 13:43634637-43634659 TCTGCTGATTACAAGATGGATGG - Intronic
1108117798 13:47149132-47149154 GATGATCTTTCCAATATTGATGG + Intergenic
1110894775 13:80735865-80735887 GTTAAATTTTACAAGATGGAAGG - Intergenic
1111213093 13:85106350-85106372 CCTTATTTTAACAAGATGGATGG + Intergenic
1112778099 13:102867222-102867244 GTTGTTCTTAACAAGAGGGAAGG + Intronic
1112885859 13:104170771-104170793 GTTGACCTTTACAAAATTGAAGG - Intergenic
1115114738 14:29866676-29866698 GTTGATGCTTACAGGATGGATGG + Intronic
1116142550 14:41017127-41017149 CCTGATTTTTAGAAGATTGAAGG - Intergenic
1116948967 14:50861397-50861419 CCTGATCTATTCAGGATGGAAGG - Intronic
1119995833 14:79252803-79252825 GCTCATCTTTACAAAACAGAGGG - Intronic
1120024317 14:79565657-79565679 GTTGAATTTTACAAAATGGAAGG + Intronic
1125003200 15:34793012-34793034 GCTGAGCTTTAAATGAGGGAAGG + Intronic
1127614007 15:60665259-60665281 GCTGACCTTTCCAAGAATGAAGG - Intronic
1127875318 15:63106757-63106779 GCTGCACTTTGCATGATGGAGGG - Intergenic
1128592134 15:68908702-68908724 GCTGATCCTTAAATGATGCAGGG + Intronic
1130154881 15:81341673-81341695 TCTTATCTTTAGAAGGTGGAGGG - Intronic
1130222190 15:82028976-82028998 GCTGTCTCTTACAAGATGGAGGG - Intergenic
1132370888 15:101297307-101297329 GCAAATCTATACAAGATGGCAGG - Intronic
1133987941 16:10682631-10682653 GCTGTCCTTTAGAAGAAGGATGG + Intronic
1147465678 17:40608863-40608885 GCTGGTCTTTGAAAGATGGGTGG + Intergenic
1149309532 17:55380610-55380632 GCTGAGCTTTGCAAGAGGCAAGG + Intergenic
1151244017 17:72780345-72780367 GCTGATCATAACTACATGGAGGG + Intronic
1156214766 18:34986282-34986304 GATGATCTTTGAAAGAAGGAAGG - Intronic
1158734920 18:60068709-60068731 TCTGTACTTTACAGGATGGATGG + Intergenic
1161137505 19:2628628-2628650 TCTCAGTTTTACAAGATGGAAGG - Intronic
1162225963 19:9223144-9223166 GCTGGTCTTTTCAAGATAGAAGG + Intergenic
1164838842 19:31377274-31377296 GTTGAGCTTTACAAGACTGATGG + Intergenic
1202675570 1_KI270711v1_random:3093-3115 GCTGAAATTCCCAAGATGGAAGG - Intergenic
925067679 2:941179-941201 TTTTATCTTTACCAGATGGAGGG - Intergenic
927582946 2:24271055-24271077 GCTGAGCTGTACAAAGTGGAAGG + Intronic
934033537 2:88068574-88068596 TCTGCACTTAACAAGATGGATGG + Intronic
936160640 2:110081869-110081891 CATGATCTTTAAAAGATAGAGGG - Intergenic
936184024 2:110289485-110289507 CATGATCTTTAAAAGATAGAGGG + Intergenic
937765779 2:125659012-125659034 GCTGCCCTTTTCATGATGGAAGG - Intergenic
939660044 2:144878176-144878198 GCGGAATTTTAAAAGATGGAGGG - Intergenic
943753265 2:191532026-191532048 GGACATCTTTACAACATGGAAGG + Intergenic
945586361 2:211668924-211668946 AGTGTACTTTACAAGATGGATGG + Intronic
948645931 2:239404549-239404571 GCTGATCTTCACAGGCAGGAGGG + Intergenic
1170295263 20:14818062-14818084 CCTGATCTATGGAAGATGGAAGG + Intronic
1180757465 22:18172656-18172678 GCAGAACTTTACAAAATGCAGGG - Intronic
1181074311 22:20364792-20364814 GCAGAACTTTACAAAATGCAGGG + Intronic
1182186759 22:28412175-28412197 TCTGTTCTTTAGAAGATGAATGG + Intronic
950879099 3:16307531-16307553 GGTGATCTTGATAAGACGGATGG + Intronic
953273378 3:41468995-41469017 GCTCAGCTTTTCAAGTTGGATGG - Intronic
953697758 3:45173000-45173022 GCTGCTCCTTCCAAGGTGGAAGG + Intergenic
955718091 3:61852248-61852270 GCTGTGCTTTCCAAGAAGGATGG + Intronic
956874078 3:73444813-73444835 GCTGGTTGTTGCAAGATGGAGGG + Intronic
957492138 3:80942240-80942262 GCTGATTTTTAAAAGATCGGGGG - Intergenic
959991704 3:112638639-112638661 GCTGATCCTTCCGGGATGGAGGG + Exonic
964702127 3:159580197-159580219 GTTGATATTTAATAGATGGATGG - Intronic
967321844 3:188202176-188202198 ACTGATGTTTACATGATGCATGG - Intronic
969383864 4:6829486-6829508 ACTGATTTTTAAAAGATGGAAGG - Intronic
974819159 4:67044365-67044387 GCTGATGTTTCCAAGACAGAAGG + Intergenic
978235176 4:106449466-106449488 GCTGATATTTACAAAATGGCAGG + Intergenic
979270556 4:118755620-118755642 GCTGATCTTTTGAAAAAGGAAGG - Intronic
980259168 4:130425365-130425387 GCTGTTCTTCACATAATGGAAGG - Intergenic
982675917 4:158375597-158375619 GTTTATCTTTAAAAAATGGATGG - Intronic
983212593 4:164974365-164974387 GCTGAACTTGCCAATATGGAGGG - Intronic
983233631 4:165154699-165154721 GCTTATCTTTTCAAGATAGATGG + Intronic
988062300 5:26186685-26186707 GCTGATCTCTAACAGATGGTTGG - Intergenic
989988292 5:50729685-50729707 GCTAATCTTGAAGAGATGGATGG - Intronic
993412428 5:87590791-87590813 TCTGCTCTTTCCATGATGGAAGG + Intergenic
993605033 5:89979432-89979454 GCACATCTTTACATGATGGCAGG + Intergenic
994860871 5:105191974-105191996 GCTGAACTTCACAAAATCGAAGG - Intergenic
995397246 5:111700045-111700067 GCTGATGTTTCTAAGATGGAAGG - Intronic
995414754 5:111896670-111896692 GCTGATCTTTATCAAATGTAAGG - Intronic
996033293 5:118730690-118730712 GTTGATTTTTATAAGATGTAAGG + Intergenic
997789520 5:136744643-136744665 GGTGATCTTTACTAGAACGATGG - Intergenic
998244431 5:140485705-140485727 ACTGATCTTGAGAAGGTGGAGGG - Exonic
998440314 5:142155214-142155236 ACTGATGTTTACAAGAAGCACGG - Intergenic
998591526 5:143483855-143483877 GCTGAACCTCACAATATGGAGGG + Intergenic
1000552796 5:162687446-162687468 ACTGATGTTTCCAAGATGGTGGG - Intergenic
1003131031 6:3395408-3395430 GCTGATCTTTACAAGATGGATGG - Intronic
1004559182 6:16730963-16730985 GCTCATATTGACAAGATAGAAGG + Intronic
1006802642 6:36769066-36769088 GCTGATATTTTCAAGAAGCATGG - Intronic
1009563960 6:65286368-65286390 GCTGATCCTTGAAAGATGAATGG - Intronic
1014356675 6:120419925-120419947 GATGATTTTTATAAAATGGATGG - Intergenic
1016144539 6:140652104-140652126 GCTGATCTCTCCTTGATGGAGGG + Intergenic
1018139819 6:160820045-160820067 GCTGATCCTTGAAAGATGAATGG - Intergenic
1018250252 6:161862441-161862463 GCTGAGCTTAACATAATGGAAGG + Intronic
1020623556 7:10548464-10548486 CCTGATCTTTACAGTCTGGACGG - Intergenic
1023461023 7:40397291-40397313 GCTGAGCTTTAAAGGATGGATGG - Intronic
1025947713 7:66117144-66117166 TCTGAATTTGACAAGATGGAGGG - Intronic
1027334517 7:77134122-77134144 GCAGAACTCTACAAGAGGGAGGG + Intronic
1028256322 7:88602431-88602453 TCTGATGTTTACAAGAAAGATGG + Intergenic
1028579595 7:92394142-92394164 TCTCATCTTTACAATGTGGATGG + Intronic
1029439495 7:100579110-100579132 GCTGATCATTTGAAAATGGAGGG - Intronic
1032445156 7:131976003-131976025 CCTGACCAATACAAGATGGAGGG - Intergenic
1033344647 7:140517755-140517777 GCTGATGGTAACAAGATGGAGGG - Intergenic
1036975567 8:13407345-13407367 GATTATCTTTCCCAGATGGAAGG - Intronic
1037266333 8:17065501-17065523 TCTGCTCTTTAAAAGATGAATGG + Intronic
1037404924 8:18532168-18532190 CCAGATCTTTACATGATAGAGGG + Exonic
1045611453 8:103847656-103847678 ACTGGCCTTTACAAGGTGGAAGG + Intronic
1047136092 8:122079982-122080004 GCTTATCTTCACAAGACAGAAGG - Intergenic
1048898990 8:139020222-139020244 GCTGATGCTTAAAAGATGGTGGG - Intergenic
1049336517 8:142089569-142089591 GCTGGCCTTTCCAGGATGGAAGG - Intergenic
1050292874 9:4175057-4175079 CCTGCTCTTTAAAAGAAGGAAGG - Intronic
1051569512 9:18540054-18540076 GCTGAGCTTTAAAAGATGAAAGG + Intronic
1055709681 9:79046635-79046657 CCTGAACTTTACAAAATGTAAGG + Intergenic
1058304965 9:103428728-103428750 GCTGGTCATTACAAGACTGAAGG + Intergenic
1059338486 9:113583842-113583864 GCAGATCTTGACAGGGTGGAAGG - Exonic
1059699958 9:116765689-116765711 GCTGATCTTTAAAAAATAGAAGG + Intronic
1187031311 X:15491287-15491309 GCTGAGCTGTAGAGGATGGAGGG + Exonic
1190113946 X:47613486-47613508 ACTGTTCTTTGCAGGATGGAAGG - Intronic
1191718800 X:64211944-64211966 GTTTGTTTTTACAAGATGGAAGG + Intergenic
1192929240 X:75787252-75787274 GCTTTTCTTTATTAGATGGAGGG - Intergenic
1197002434 X:121453941-121453963 TCTGCTCTTTCCATGATGGAAGG - Intergenic
1197655635 X:129113258-129113280 GCTGCTCTTTACTAGGTGGAAGG + Intergenic
1201417105 Y:13758334-13758356 CCTTATCTTTACAAGAAGGAGGG - Intergenic