ID: 1003132267

View in Genome Browser
Species Human (GRCh38)
Location 6:3404968-3404990
Sequence AAAGATTTGTCGGCCAGGTG CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1003132261_1003132267 28 Left 1003132261 6:3404917-3404939 CCCATCTGAACCTCAGTAAAATC 0: 1
1: 0
2: 0
3: 14
4: 242
Right 1003132267 6:3404968-3404990 AAAGATTTGTCGGCCAGGTGCGG No data
1003132264_1003132267 -1 Left 1003132264 6:3404946-3404968 CCTTTGAAGCTTAAAAAAAAAAA 0: 1
1: 4
2: 66
3: 615
4: 3682
Right 1003132267 6:3404968-3404990 AAAGATTTGTCGGCCAGGTGCGG No data
1003132263_1003132267 18 Left 1003132263 6:3404927-3404949 CCTCAGTAAAATCAAAATTCCTT 0: 1
1: 0
2: 1
3: 47
4: 511
Right 1003132267 6:3404968-3404990 AAAGATTTGTCGGCCAGGTGCGG No data
1003132262_1003132267 27 Left 1003132262 6:3404918-3404940 CCATCTGAACCTCAGTAAAATCA 0: 1
1: 0
2: 0
3: 26
4: 343
Right 1003132267 6:3404968-3404990 AAAGATTTGTCGGCCAGGTGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1003132267 Original CRISPR AAAGATTTGTCGGCCAGGTG CGG Intronic
No off target data available for this crispr