ID: 1003132369

View in Genome Browser
Species Human (GRCh38)
Location 6:3405755-3405777
Sequence TCTAATGTGCTGGTGTTGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 402
Summary {0: 1, 1: 0, 2: 2, 3: 29, 4: 370}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1003132369_1003132373 11 Left 1003132369 6:3405755-3405777 CCATCCAACACCAGCACATTAGA 0: 1
1: 0
2: 2
3: 29
4: 370
Right 1003132373 6:3405789-3405811 CACTTCTGTCATGTGAAAAAGGG 0: 1
1: 0
2: 4
3: 50
4: 660
1003132369_1003132372 10 Left 1003132369 6:3405755-3405777 CCATCCAACACCAGCACATTAGA 0: 1
1: 0
2: 2
3: 29
4: 370
Right 1003132372 6:3405788-3405810 TCACTTCTGTCATGTGAAAAAGG 0: 1
1: 0
2: 10
3: 40
4: 476

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1003132369 Original CRISPR TCTAATGTGCTGGTGTTGGA TGG (reversed) Intronic
901056168 1:6449455-6449477 TCTGATGAGCTGGTACTGGAGGG + Intronic
901703781 1:11059313-11059335 GGCAACGTGCTGGTGTTGGACGG - Exonic
902093722 1:13925343-13925365 TCTAATGTGGTTATGTTGAAAGG + Intergenic
902478191 1:16699039-16699061 TCTGATGAGCTGGTACTGGAGGG - Intergenic
904282541 1:29431135-29431157 TGCATTGTGGTGGTGTTGGAAGG + Intergenic
904967589 1:34389644-34389666 TGTATTGTGCTGTTGTTGGATGG + Intergenic
908245427 1:62224135-62224157 TCCAATGTGATGGTATTTGAAGG + Intergenic
908790412 1:67775535-67775557 TCTGATGAGCTGCTGGTGGATGG + Intronic
908883089 1:68755370-68755392 TCTATTTTGCTGTTGTTGGGTGG - Intergenic
909915263 1:81310096-81310118 TCTAATGTGCTGGTGTATTTTGG - Intronic
911145352 1:94547134-94547156 TCCAATGTGATGGTGTTAGGAGG + Intergenic
911965919 1:104371593-104371615 TGTATTCTGCTGCTGTTGGATGG - Intergenic
912133888 1:106635948-106635970 ATTATTGTTCTGGTGTTGGAAGG + Intergenic
916923031 1:169488400-169488422 TTTGACGTGCTGCTGTTGGAGGG + Intergenic
917297752 1:173539566-173539588 TCTAAAGAGCTGGTGTTGAAAGG + Intronic
919136821 1:193519956-193519978 TCCAATGTGATGGTATTAGAAGG - Intergenic
919514489 1:198505706-198505728 TGTATTCTGCTGCTGTTGGATGG + Intergenic
920883562 1:209902884-209902906 ACTAGTGTGCTGGTGTTTGCTGG + Intergenic
921910367 1:220542429-220542451 TTGAATGTGCTGGTATTTGATGG + Intronic
923774137 1:236963267-236963289 CCTGATGTGGTGGTATTGGAGGG - Intergenic
924170069 1:241329791-241329813 TCTTGTGTGCTGCTGGTGGATGG + Intronic
924893685 1:248312957-248312979 TGTATTGTGCTGGTTTTCGAAGG + Intergenic
1062785431 10:260797-260819 TGTACTGTGCAGGTGTTGTATGG - Intergenic
1062953471 10:1523461-1523483 TCTAATGTGAGGGGGTGGGATGG - Intronic
1063770800 10:9197476-9197498 ACTAATGTGCTGGCATTAGAAGG - Intergenic
1063790900 10:9446124-9446146 TGTATTGTGCTGTTGTTGCATGG + Intergenic
1063833243 10:9981204-9981226 TCTAATGTGTTGGAGTTAAATGG + Intergenic
1064014007 10:11758970-11758992 CCCAAGGTGATGGTGTTGGAAGG + Intronic
1065412172 10:25441497-25441519 TCTCATGTGCTTGGGTTGGGTGG + Intronic
1066312744 10:34213412-34213434 CCCAATGTGGTGGTGTTGGGAGG - Intronic
1066765270 10:38796951-38796973 TGTAATGTACTGGAGTTGAATGG - Intergenic
1069150284 10:64951703-64951725 TGTATTCTGCTGTTGTTGGATGG + Intergenic
1069588359 10:69625953-69625975 TCCATTCTGCTGGTTTTGGATGG - Intergenic
1069768705 10:70883769-70883791 TCTAAATTCCTGGTGTTGGTGGG + Exonic
1071896541 10:90074283-90074305 TTTAAAGTGCTGGGGGTGGAGGG - Intergenic
1072254448 10:93607786-93607808 TCTAATGTGATGGTATTAGACGG - Intergenic
1073104083 10:101022314-101022336 TCTTCTGAGCTGGTGTCGGAGGG + Exonic
1073168364 10:101478529-101478551 TCTAATGTGCTGGGATTACAGGG - Intronic
1073177228 10:101564032-101564054 TCCAATGTGCTGGGATTGCAAGG - Intergenic
1073701957 10:105936577-105936599 TGTATTCTGCTGTTGTTGGATGG - Intergenic
1074724947 10:116298883-116298905 TCTTATTTCCTGGTGTTGGAAGG - Intergenic
1075477153 10:122745844-122745866 ACAAATGTGCAGGTGTTGCATGG + Intergenic
1076431444 10:130406176-130406198 TGTATTCTGCTGTTGTTGGATGG - Intergenic
1078167595 11:8901924-8901946 TGTATTGTGCTATTGTTGGATGG + Intronic
1078284415 11:9936988-9937010 CCTGATGTGTTGGTGTTGGGAGG - Intronic
1078530984 11:12136666-12136688 TCTAATTTGTTGGTGTTACAGGG + Intronic
1079257228 11:18841921-18841943 TCTCTTGTGCTGGTTTTCGAAGG - Intergenic
1079476095 11:20830908-20830930 TCCAGTGTGGTGGTGTTGGGGGG - Intronic
1079946491 11:26748885-26748907 TCTAATGGGGTGGGGGTGGAGGG + Intergenic
1080158401 11:29141290-29141312 TCCATTTTGCTGTTGTTGGAGGG + Intergenic
1080284108 11:30587813-30587835 TCAAATGTGCTGGGGTGGAAAGG + Intergenic
1080904722 11:36530774-36530796 TGTATTCTGCTGTTGTTGGATGG + Intronic
1081376266 11:42362287-42362309 CCTAATGTGATGGTATTGGGAGG + Intergenic
1082122874 11:48398277-48398299 TCCAATGTGAAGGTGTTTGAAGG - Intergenic
1082556572 11:54569553-54569575 TCCAATGTGAAGGTGTTTGAAGG - Intergenic
1082931620 11:58613401-58613423 CCCAATGTGATAGTGTTGGAAGG - Intronic
1084012051 11:66357200-66357222 TCTAAAGTGCTGGGATTGGCGGG + Intronic
1084669442 11:70596460-70596482 TCTAGGGTTCTGGGGTTGGAAGG + Intronic
1085030874 11:73270270-73270292 TCTCATGAGCTGGGGTTGCAAGG + Intronic
1086243618 11:84724899-84724921 TCTAATGTTCTCATGGTGGAAGG + Intronic
1086541046 11:87913593-87913615 CCTAATGTGGTGGTATTGGGAGG + Intergenic
1086727009 11:90198960-90198982 CTTAATCTGGTGGTGTTGGATGG - Intergenic
1086988998 11:93282141-93282163 TCCAATGTGATGGGGTTTGAAGG - Intergenic
1087300690 11:96431108-96431130 TCTCTTGTGCTGGTTTTCGAGGG - Intronic
1087459727 11:98430706-98430728 TATATTCTGCTGCTGTTGGATGG + Intergenic
1087499019 11:98928175-98928197 GCCATTGTGTTGGTGTTGGAAGG + Intergenic
1088045554 11:105446418-105446440 TGTATTTTGCTGCTGTTGGATGG - Intergenic
1088070406 11:105777038-105777060 GTTTATGTGCTGGTGTTGGCTGG - Intronic
1088284480 11:108172309-108172331 TCTAATGTAGTGGTGTTGCCTGG - Exonic
1089085992 11:115817212-115817234 TCTAAAGTGCTGGGATTGCAGGG - Intergenic
1090174146 11:124632814-124632836 CCTAATGTGATGGTATTGGGAGG - Exonic
1090559265 11:127912970-127912992 TGTATTGTGCAGTTGTTGGATGG + Intergenic
1090979582 11:131706512-131706534 TGTATTTTGCTGCTGTTGGATGG - Intronic
1091327388 11:134701306-134701328 TCCAAGGTGCTGGTGTTAGGAGG + Intergenic
1092009445 12:5097338-5097360 ACAAATGTGCGGGTGTTGGAAGG - Intergenic
1092625999 12:10329467-10329489 TATACTCTGCTGCTGTTGGATGG + Intergenic
1092792099 12:12079174-12079196 TCTATTGTGTTTGTGCTGGAGGG - Intronic
1093857996 12:24128737-24128759 TATAATGAGCTGCTATTGGAGGG + Intergenic
1094254855 12:28411954-28411976 TCCAATGTGGTGGTGTTGGGGGG - Intronic
1095319718 12:40812344-40812366 TGTATTCTGCTGCTGTTGGATGG + Intronic
1095823187 12:46503017-46503039 TGTATTATGCTGCTGTTGGATGG + Intergenic
1097407270 12:59204775-59204797 TGTATTCTGCTGTTGTTGGATGG - Intergenic
1099302993 12:80921065-80921087 ACCAATGTGATGGTGTTAGAAGG + Intronic
1100344980 12:93720392-93720414 TGTAATCTGCTGTTGTTTGATGG + Intronic
1100813770 12:98365809-98365831 ACTCATGTGCTAGTATTGGAAGG - Intergenic
1100983990 12:100187833-100187855 TCTAATGTGTTAGAATTGGAAGG - Intergenic
1101119603 12:101565247-101565269 TCCAATGTGATGGTGTTAGGAGG - Intergenic
1101420403 12:104546041-104546063 CCCAATGTGCTGGTATTAGAAGG - Intronic
1101480701 12:105094054-105094076 TGTATTTTGCTGTTGTTGGATGG + Intergenic
1102708038 12:114899532-114899554 TATAAGGTGCTGGGGTGGGAGGG + Intergenic
1102969629 12:117155814-117155836 TATAACGTGCTGGTGGAGGACGG - Exonic
1103449389 12:121017494-121017516 TCTAATTTTTTGGTCTTGGATGG - Intergenic
1106171947 13:27296174-27296196 ACTAATGTGATGGTATTGGGAGG + Intergenic
1107091338 13:36484226-36484248 TGTATTCTGCAGGTGTTGGATGG + Intergenic
1107245214 13:38285913-38285935 CCTAATGTGATGGTATTAGAAGG + Intergenic
1108086810 13:46802193-46802215 TCTAATGTGTTGGTGTTAAGAGG + Intergenic
1109276943 13:60313894-60313916 TCTAATGTGTTGGAGTGAGAAGG + Intergenic
1109939408 13:69341469-69341491 TGTAATGTGCTGCTGGTGGATGG + Intergenic
1111278988 13:85993350-85993372 TATATTCTGCTGCTGTTGGATGG + Intergenic
1113031018 13:105993604-105993626 TCTAATGTGATGGTATTTGAAGG - Intergenic
1115261850 14:31462458-31462480 TCCAATGTGCTGGGATTGCAGGG - Intergenic
1115540562 14:34415923-34415945 TGTATTTTGCTGCTGTTGGATGG - Intronic
1116016368 14:39412024-39412046 TGTATTCTGCTGTTGTTGGATGG + Intronic
1116186192 14:41604338-41604360 TCTAATCAGCTTGTGTAGGAGGG + Intergenic
1118969733 14:70624434-70624456 TATATTCTGCTGTTGTTGGATGG - Intergenic
1118982140 14:70725510-70725532 ACTCAGGTGCTGGTGTTGGAAGG - Intronic
1119167051 14:72503220-72503242 CCTAATGTGATGGTTTTGGGAGG - Intronic
1119696762 14:76719573-76719595 TTTCCTGGGCTGGTGTTGGAGGG + Intergenic
1120651794 14:87142654-87142676 TCATCTATGCTGGTGTTGGAAGG - Intergenic
1120957711 14:90097515-90097537 CCCAATGTGGTGGTGGTGGAAGG - Intronic
1121277969 14:92680578-92680600 TCCAATGTGATGGTGTTAGGAGG - Intronic
1121719347 14:96098353-96098375 CCTAATGTGATGGTATTGGGAGG + Intergenic
1122062641 14:99146995-99147017 CCTACTGCGCTGTTGTTGGAAGG - Intergenic
1124193815 15:27603043-27603065 CCTAATATGATGGTGTTGGGAGG + Intergenic
1127811847 15:62572003-62572025 TCTGATGTGCTGATATGGGAGGG + Intronic
1129588559 15:76893596-76893618 TATATTCTGCTGCTGTTGGATGG - Intronic
1130771851 15:86932175-86932197 TCAAATGGGAGGGTGTTGGAAGG - Intronic
1131016280 15:89060047-89060069 TCTTAGGGGCTGGTGTTGAAGGG - Intergenic
1131433939 15:92408265-92408287 TCTAATCTAGTGGTGTTGCAGGG - Intronic
1131768166 15:95703001-95703023 GATAATCTGCTGCTGTTGGATGG + Intergenic
1131918572 15:97297958-97297980 TGTATTCTGCTGCTGTTGGATGG + Intergenic
1132159698 15:99528265-99528287 TATATTCTGCTGCTGTTGGATGG + Intergenic
1132248849 15:100318354-100318376 TACAATGTGATGGTGTTGGAAGG + Intronic
1132376120 15:101329357-101329379 TCTGGTGTGCTGTTCTTGGATGG - Intronic
1132440134 15:101854188-101854210 TGTATTGTGCTGCTGTTGGGTGG + Intergenic
1133888340 16:9853311-9853333 CCTAATGTGGTGGTGTTAGGAGG + Intronic
1133951214 16:10394550-10394572 TCTATTCTGCTGTTGTTGGGTGG - Intronic
1133985443 16:10664815-10664837 TCTCATCTGCTGATGTGGGAGGG - Intronic
1134621558 16:15693329-15693351 TCTCATGTGCTGCTGGTGCATGG + Intronic
1135294604 16:21268389-21268411 TGAAAGGTGCTGGGGTTGGAGGG + Intronic
1135352904 16:21744755-21744777 TCCAATGTGATAGTATTGGAAGG - Intronic
1135451390 16:22560878-22560900 TCCAATGTGATAGTATTGGAAGG - Intergenic
1135786546 16:25354331-25354353 TGTATTCTGCTGTTGTTGGAAGG - Intergenic
1135973900 16:27093417-27093439 TATATTCTGCTGATGTTGGATGG - Intergenic
1138208563 16:55143612-55143634 CCCAATGTGCTGGTGTTGGGAGG + Intergenic
1138215363 16:55199984-55200006 TCCAATGTGGTAGTGATGGAAGG + Intergenic
1139205950 16:65028497-65028519 TCTTATGTGTGGGTGTTGGAGGG - Intronic
1139269653 16:65670382-65670404 CCTAGTGTGGTGGTGTTGGAAGG - Intergenic
1140451787 16:75076731-75076753 CCTAATGTGATGGTATTTGAAGG + Intronic
1140838789 16:78819738-78819760 TCCACTGTGCTGGTGATGCAGGG - Intronic
1141663078 16:85452239-85452261 CCTAATGTGATGATGTTTGATGG + Intergenic
1141782395 16:86172120-86172142 CTCAATGTGATGGTGTTGGATGG + Intergenic
1144324939 17:14169827-14169849 CCTAATGTTTTGGTGTTGGGAGG + Intronic
1146592850 17:34143369-34143391 CCAAATGTGATGGTGTTGGGAGG + Intronic
1148966232 17:51438297-51438319 CCTAATGTGCTAGAGTTTGAAGG - Intergenic
1149332468 17:55599793-55599815 TGTATTCTGCTGCTGTTGGATGG + Intergenic
1151198453 17:72449408-72449430 TCAAATGTGCGTGTGTTGGGAGG - Intergenic
1151998315 17:77627511-77627533 TGTATTCTGCTGTTGTTGGATGG + Intergenic
1203199441 17_KI270729v1_random:262068-262090 TCGAATGTAATGGTGTTGAATGG + Intergenic
1203209041 17_KI270730v1_random:62808-62830 TCGAATGTAATGGTGTTGAATGG + Intergenic
1155702627 18:28766685-28766707 TCTAATGTGATGGTATTTGGAGG + Intergenic
1155800913 18:30102381-30102403 TCCACTGTGCTGGTGCTGGTCGG - Intergenic
1158107872 18:53905674-53905696 TCAAATGTGCTGCTTTAGGATGG + Intergenic
1159291024 18:66420215-66420237 AGCAATGTGCTGGTGATGGAAGG + Intergenic
1159909046 18:74126409-74126431 TGTATTGTGCTGGATTTGGAGGG - Intronic
1162254682 19:9480147-9480169 TGTATTTTGCTGCTGTTGGATGG - Intronic
1164851748 19:31489895-31489917 TCTCATTTGCTGGGGGTGGAGGG + Intergenic
1164919282 19:32076832-32076854 GCTGGTGTGCTGGTGTTGGTGGG - Intergenic
1164947113 19:32305238-32305260 TCTAATGTGCTGCTGTGGCTGGG - Intergenic
1165184802 19:34008642-34008664 TCCAATGTGGTGTTGTTGGGAGG - Intergenic
1166966094 19:46530121-46530143 TCTAAGGAGCTGGGGGTGGAAGG - Intronic
1168504397 19:56921116-56921138 TCTAAGGTGATGGTGTTAGGAGG + Intergenic
1202712212 1_KI270714v1_random:24867-24889 TCTGATGAGCTGGTACTGGAGGG - Intergenic
925582464 2:5425197-5425219 CCTAATGTGATGGTATTGGGAGG - Intergenic
925842651 2:8006942-8006964 TCTAATGGGATGGTATTAGAAGG + Intergenic
926383631 2:12315175-12315197 CCTCATGTGCTGGTATTTGAAGG - Intergenic
926527510 2:13999582-13999604 TGTATTCTGCTGGTATTGGATGG - Intergenic
929245692 2:39700110-39700132 TGTATTTTGCTGTTGTTGGATGG + Intronic
929890965 2:45918254-45918276 TCTCATGTGCTGGCTGTGGAAGG + Intronic
929963624 2:46516204-46516226 TGTATTGTGCTGCTGTTGGGTGG - Intronic
932117776 2:69068668-69068690 TGTAATGGGTTGGTGTTGAAGGG + Intronic
932637618 2:73405987-73406009 TATATTGTGCTGTTGTTGGGTGG + Intronic
933673668 2:85033704-85033726 TCCAATGTGGTGGTGTTGGAAGG - Intronic
934684913 2:96313934-96313956 TAGACTGTGCTGCTGTTGGAAGG - Intergenic
935624426 2:105158705-105158727 TGTATTCTGCTGCTGTTGGATGG - Intergenic
938047997 2:128140401-128140423 AGCAGTGTGCTGGTGTTGGATGG - Intronic
939841318 2:147191133-147191155 TGTATTCTGCTGTTGTTGGATGG - Intergenic
940441196 2:153718845-153718867 TATAATGTGCTGTTATTGAATGG + Intergenic
941380337 2:164784913-164784935 TCTAATGTGACCGTGTTGGGAGG + Intronic
942170842 2:173288216-173288238 TCCAATGTGATGGTGTTAGGAGG + Intergenic
942715592 2:178888150-178888172 TCTACAGTCCTGGTGTTGTATGG + Intronic
943169408 2:184377662-184377684 TCCAATGTGGAGGTGTTGGGAGG - Intergenic
944057986 2:195543543-195543565 CCTAATGTGATGGTATTGGGAGG - Intergenic
944295262 2:198054351-198054373 TGTATTCTGCTGCTGTTGGATGG - Intronic
945562026 2:211351167-211351189 TCCAGTGTGGTGGTGTTGGGAGG - Intergenic
945732543 2:213556770-213556792 TGTATTGTTCTGCTGTTGGATGG - Intronic
945778363 2:214135533-214135555 TCCAGTGTAATGGTGTTGGAAGG + Intronic
946164047 2:217853109-217853131 TCTAATGTGGCCGTGGTGGATGG - Intronic
947205207 2:227654559-227654581 TATTATGTCGTGGTGTTGGAAGG + Intergenic
947334123 2:229063589-229063611 TGTAATCTGCTGCTGTTGAATGG + Intronic
947812637 2:233014208-233014230 TCCAAGCTGCTGGTGTTGGCAGG + Intronic
1168900100 20:1356227-1356249 TGTATTCTGCTGCTGTTGGATGG + Intronic
1169949476 20:11027408-11027430 TCTAATGAGCTGGAGTTGGAAGG - Intergenic
1170753754 20:19177560-19177582 TTTATTCTGCTGTTGTTGGATGG - Intergenic
1170777269 20:19387783-19387805 TGTATTCTGCTGCTGTTGGATGG + Intronic
1171042734 20:21780587-21780609 TCTATGGTGGTGGTGGTGGAAGG + Intergenic
1171323648 20:24270073-24270095 TGTATTGTGCTGTTGTTGGATGG + Intergenic
1171726699 20:28628652-28628674 TATATTCTGCTGCTGTTGGATGG - Intergenic
1171751572 20:29055959-29055981 TATATTCTGCTGCTGTTGGATGG + Intergenic
1171790768 20:29521917-29521939 TATATTCTGCTGCTGTTGGATGG - Intergenic
1171856940 20:30354919-30354941 TATATTCTGCTGCTGTTGGATGG + Intergenic
1173045719 20:39508489-39508511 TATAATGTGCTATTGTTGGATGG - Intergenic
1174065231 20:47859950-47859972 AGCAATATGCTGGTGTTGGATGG + Intergenic
1174825797 20:53767209-53767231 CCTAATGTGTTGGTATTTGAAGG + Intergenic
1177203630 21:17986027-17986049 TCCAATGTGATGGTATTAGAAGG - Intronic
1177720544 21:24901439-24901461 TCCAATGTGATGGTGTTAGGAGG + Intergenic
1177847550 21:26308229-26308251 TGTATTCTGCTGTTGTTGGATGG - Intergenic
1178306541 21:31495543-31495565 TCTAGTATGATGGTGTTGGGAGG - Intronic
1178399575 21:32273658-32273680 CCTAATGTGATGGTATTGGGAGG + Intronic
1179835278 21:44027753-44027775 CCTAATGTGATGGTTTTGGGAGG + Intronic
1179899251 21:44380472-44380494 TTTAATCTGCTGTTGTTGAAAGG + Intronic
1182609628 22:31536285-31536307 GCCAATGAGCTGTTGTTGGAAGG - Intronic
1182712355 22:32330849-32330871 TCTGGTGTGTAGGTGTTGGAGGG + Intergenic
949897710 3:8780906-8780928 TGTATTCTGCTGCTGTTGGATGG - Intronic
950703102 3:14763494-14763516 CCTAAGGTGATGGTGTTGGGAGG - Intronic
950726390 3:14919904-14919926 CCAAAGGTGCTGGTGTTGGGAGG - Intronic
954640697 3:52096078-52096100 TGTAATGTGCTGGTGGTTGTGGG - Intronic
954900251 3:54013297-54013319 TCTATTGTGTTGGTGTTCCATGG + Intergenic
954926518 3:54240667-54240689 TCTCATCTGCTGGTTTTGTAAGG + Intronic
954929910 3:54272436-54272458 TCAAATGTGCTGGTTGTGGGAGG + Intronic
954944111 3:54402804-54402826 TATATTCTGCTGCTGTTGGATGG - Intronic
955527334 3:59834722-59834744 TCCATTGTGATGGTGTTTGAAGG - Intronic
955602751 3:60665241-60665263 TATATTCTGCTGTTGTTGGATGG + Intronic
955785111 3:62529410-62529432 TCCAAGGTGCTGCTTTTGGAAGG - Intronic
956175137 3:66465786-66465808 TCTAAAGTTCTGGAGATGGACGG - Intronic
956324768 3:68039896-68039918 GCCAATGTGCTGGAGTTGGCGGG - Intronic
956757985 3:72408779-72408801 TCCAATGTGCCGGTGTTAGAGGG + Intronic
957671776 3:83314373-83314395 TCCAATGTGGTGATGTTGGGAGG + Intergenic
957909293 3:86601668-86601690 TCTAAAATCCAGGTGTTGGAGGG + Intergenic
958600832 3:96294468-96294490 TCTAATGTGATAGTATTTGAAGG - Intergenic
959235478 3:103716958-103716980 TGTATTCTGCTGATGTTGGATGG + Intergenic
961008135 3:123418698-123418720 TCCGATGTGGTGGTGTTGGAAGG - Intronic
962110758 3:132444119-132444141 TCTCATGTGCAGGAGGTGGATGG - Intronic
963073839 3:141328565-141328587 GCTAAGGTGCTGAGGTTGGAGGG - Intronic
963412329 3:144945901-144945923 TCCAATGTGATGGTATTTGAAGG + Intergenic
964174904 3:153816183-153816205 TCCAATTTGGTGGTGTTGGGAGG + Intergenic
964535281 3:157714941-157714963 TCTATAGTGGTGGTGTTGGAGGG + Intergenic
964856753 3:161154265-161154287 CCTAATGTGATGGTGTTAGGAGG + Intronic
965090183 3:164151494-164151516 TCTAATATAATGGTGTTGGAAGG + Intergenic
965210673 3:165782936-165782958 ACTAAGGTGCTGGTATTAGAAGG - Intronic
965610605 3:170539757-170539779 TCTACTGTGGAGGTCTTGGAAGG - Intronic
967148093 3:186623110-186623132 GCTGATGTACTGGTGTTGGGAGG + Intergenic
971103934 4:23500623-23500645 CCTAATGTGATGGTATTTGAAGG - Intergenic
971550375 4:27947972-27947994 TCTCTTGGGCTGGTGATGGAAGG - Intergenic
971711082 4:30113449-30113471 CCCAATGTGATGGTGTTGCAGGG - Intergenic
973929378 4:55774871-55774893 TGTATTTTGCTGCTGTTGGATGG - Intergenic
974331430 4:60483875-60483897 TCTAATGTGATGGTATTTGGAGG + Intergenic
977119553 4:93081052-93081074 CCCAATGTGTTGGTGTTGGGAGG - Intronic
977199232 4:94096261-94096283 TGTATTGTGCAGCTGTTGGATGG + Intergenic
977378667 4:96241465-96241487 TCTAATGTGATAGTATTAGAAGG + Intergenic
977712253 4:100140138-100140160 TGTATTCTGCTGTTGTTGGATGG + Intergenic
977786936 4:101046883-101046905 TCAAAGGTGCTGATTTTGGATGG - Intronic
978081908 4:104603987-104604009 TGTATTCTGCTGCTGTTGGATGG + Intergenic
978822803 4:112985323-112985345 TGTAATGTGTTGGTGTAGGTGGG - Intronic
978925955 4:114244649-114244671 TGTAGTCTGCTGCTGTTGGATGG + Intergenic
979109634 4:116736255-116736277 TCTAATGTGCTGTTGCTAAATGG - Intergenic
979532513 4:121784354-121784376 TCTAATGTGATGGTATTTGCAGG + Intergenic
979563693 4:122130006-122130028 TGTATTTTGCTGTTGTTGGATGG + Intergenic
979958376 4:126984500-126984522 TGTATTCTGCTGCTGTTGGATGG + Intergenic
982210960 4:153035981-153036003 TATAATGAGTTGGTCTTGGAAGG + Intergenic
983155272 4:164339250-164339272 TGTATTCTGCTGCTGTTGGATGG - Intronic
983519714 4:168695241-168695263 ACTAAGGTGCTGTTGTAGGAGGG + Intronic
983852642 4:172601328-172601350 ACTAATGTGGTAGTGTTGGGAGG + Intronic
984349475 4:178571672-178571694 TCCAATGTGGTGGTGTTGATAGG - Intergenic
985179764 4:187246064-187246086 TGTATTCTGCTGCTGTTGGATGG + Intergenic
985375169 4:189328347-189328369 TGTATTCTGCTGCTGTTGGATGG + Intergenic
985546174 5:510286-510308 TCTAAGGTGTTCGTGTGGGACGG + Intronic
985826451 5:2195176-2195198 TCTAATGGGCTTGTCTTAGAAGG + Intergenic
986114221 5:4753655-4753677 GCTAATGTCATGGTGTTGGCAGG - Intergenic
986145480 5:5073503-5073525 TCCAATGTGATGGTATTGGGAGG + Intergenic
986860501 5:11921471-11921493 ACTAATACGCTGGTGGTGGAGGG + Intergenic
987185410 5:15412311-15412333 CCTAATGTGGTGGTGTTAGGAGG - Intergenic
988037242 5:25842944-25842966 TGTACTTTGCTGCTGTTGGATGG - Intergenic
988352752 5:30133021-30133043 TATACTCTGCTGATGTTGGATGG + Intergenic
988522177 5:31956083-31956105 TGTATTCTGCTGCTGTTGGATGG + Intronic
988711150 5:33776247-33776269 TATATTTTGCTGCTGTTGGATGG - Intronic
991108767 5:62873116-62873138 TTTAATGTTCTTTTGTTGGAGGG - Intergenic
991463872 5:66889168-66889190 TGTAATTTGCTGGTAATGGATGG + Intronic
991479182 5:67058609-67058631 TTTCATGTGCTGGTATTGGAAGG + Intronic
992136313 5:73749674-73749696 TCAAATGTGTTGTTGTTGGAAGG + Intronic
994260617 5:97654360-97654382 TGTATTCTGCTGCTGTTGGATGG - Intergenic
994562263 5:101389973-101389995 TCAAATGTGTGTGTGTTGGATGG - Intergenic
994589198 5:101752894-101752916 GCTCAGGTGCTGGTCTTGGAGGG - Intergenic
995545690 5:113228223-113228245 TCTAATGTAATGGTGTTGAGTGG + Intronic
995761759 5:115569845-115569867 TCTAATTTTCTGGCTTTGGAAGG + Intergenic
995792690 5:115908408-115908430 TCTAAGGTACTGATGGTGGAAGG + Intronic
996245200 5:121254972-121254994 TCCAATGTGATGGTATTTGAAGG + Intergenic
996908489 5:128630088-128630110 TCTAATGTGCTGAGGTTTGGGGG + Intronic
998276995 5:140765184-140765206 TGTATTCTGCTGTTGTTGGATGG + Intergenic
998589599 5:143463613-143463635 CCTAATATGGTGGTGTTGGGAGG - Intergenic
998589926 5:143466003-143466025 CCCAATGTGATGGTGTTGGGAGG - Intergenic
998719639 5:144930268-144930290 TGTACTCTGCTGCTGTTGGATGG - Intergenic
999168610 5:149573242-149573264 TCCCATGTGGTGGTGTTGGGAGG - Intronic
999615732 5:153421131-153421153 TCTCATGGGGTGGTGTAGGAAGG - Intergenic
1000669193 5:164039574-164039596 TCTAAGGTGATGGTGTTGGTAGG - Intergenic
1001947342 5:175790935-175790957 CCCAATGTGATTGTGTTGGAAGG + Intergenic
1003132369 6:3405755-3405777 TCTAATGTGCTGGTGTTGGATGG - Intronic
1003187363 6:3843890-3843912 GATACTGTGGTGGTGTTGGAGGG + Intergenic
1003505799 6:6739309-6739331 CCAAATGTGCTGTTGTTTGAAGG + Intergenic
1003987177 6:11448405-11448427 TCCACTGTGGTGGTGTTGGCAGG - Intergenic
1004842732 6:19605858-19605880 TCCATTGTGGTGGTGTTGGGAGG - Intergenic
1004842741 6:19605899-19605921 CCCAGTGTGCTGGTGTTGGGAGG - Intergenic
1004875895 6:19954299-19954321 TTTAAAGTGTTGGTATTGGAAGG + Intergenic
1005468719 6:26141069-26141091 TCCAATGTGCACGTGCTGGATGG - Intergenic
1005904868 6:30253481-30253503 TCTAATGTGATGGTGTTTGGAGG + Intergenic
1005922019 6:30410248-30410270 TCTAATGTGATGGTGTTTGGAGG - Intergenic
1007662173 6:43493543-43493565 TCTCCTGGGCTGGTGTTGAAGGG + Intronic
1008732412 6:54498815-54498837 TGTATTCTGCTGCTGTTGGATGG - Intergenic
1008770515 6:54973161-54973183 GCTTAGGCGCTGGTGTTGGATGG - Intergenic
1009584841 6:65587264-65587286 TTTAATGTGATGGTGTTAAAAGG + Intronic
1010080985 6:71862117-71862139 TGTATTCTGCTGTTGTTGGAAGG + Intergenic
1010259973 6:73804527-73804549 TCTTAGGTGGTGGTGTTGGCAGG + Intronic
1010784743 6:79987204-79987226 ACCAATGTGATGGTGTTGGGAGG + Intergenic
1012188575 6:96252827-96252849 TCTAATTTGCTTCTGATGGAAGG + Intergenic
1015486951 6:133782585-133782607 TATATTCTGCTGCTGTTGGATGG + Intergenic
1018035159 6:159875411-159875433 TCTAATGTGGCAGTGTTGGGCGG + Intergenic
1018626162 6:165780951-165780973 TCCAATGTGGTAGTGTTGGGTGG + Intronic
1018940063 6:168303312-168303334 CCCAATGTGGTGGTGTTGGGAGG + Intronic
1019202867 6:170333203-170333225 ACTAATGTGATGGTATTGGGAGG + Intronic
1022323734 7:29310851-29310873 TCCAATGTGATGGTGTCAGAAGG - Intronic
1023702293 7:42904721-42904743 GCTGATTTGCTGGTGGTGGAAGG + Intergenic
1024981190 7:55158961-55158983 ACTGATGTTCAGGTGTTGGATGG - Intronic
1026849695 7:73717159-73717181 CCAAATGTGGTGGTGTTGGGTGG + Intronic
1027651654 7:80875612-80875634 CCTAGTGTGATGGAGTTGGATGG - Intronic
1027689212 7:81321101-81321123 TCCAATGTGATGGTTGTGGATGG - Intergenic
1028174175 7:87634231-87634253 TCCAATGTGATGGTGTTGGGAGG - Intronic
1028197573 7:87925097-87925119 CCTAATGTGGTGGTATTTGAAGG + Intergenic
1028626026 7:92878215-92878237 TGTATTCTGCTGCTGTTGGATGG - Intergenic
1028735096 7:94200621-94200643 TGTATTCTGCTGCTGTTGGATGG + Intergenic
1029935660 7:104421828-104421850 TCCAATGTGATGGTGTTAGGAGG + Intronic
1029997240 7:105018753-105018775 TGTAATGTGCAGATGTTGGGAGG + Intronic
1030115138 7:106057219-106057241 TCTAATTTGCTGGAGTCGGCTGG - Intergenic
1031221608 7:118973660-118973682 TCCAATGTGATGGTATTTGAAGG + Intergenic
1032211671 7:129920879-129920901 TAAAATGTCCTGGTGTTGGCCGG + Intronic
1032346251 7:131119382-131119404 TTTCATGGGCTGGTGTTGAATGG + Intronic
1032361222 7:131257146-131257168 TCGATTGTGCTGTTGTTGGTTGG - Intronic
1032577244 7:133068422-133068444 AATAATGTGATGATGTTGGAAGG + Intronic
1032770950 7:135055194-135055216 CCTAATGTGCCAGTGTTGGGAGG - Intronic
1033613274 7:142986329-142986351 CCCAATGTGGTGGTGTTGGGAGG - Intergenic
1033709810 7:143930947-143930969 TGTATTCTGCTGCTGTTGGATGG + Intergenic
1033896156 7:146073284-146073306 TCTTATGTGATGGTGTTTGGTGG - Intergenic
1037179116 8:15983125-15983147 ACTAATCTGCTGGACTTGGAGGG + Intergenic
1038814317 8:30885676-30885698 TCTAACGTGCTACTGTTGAATGG + Intronic
1039009887 8:33081944-33081966 TGTATTCTGCTGCTGTTGGATGG + Intergenic
1040607408 8:48947721-48947743 TGTATTCTGCTGCTGTTGGATGG + Intergenic
1040973606 8:53164843-53164865 CCCAATGTGGTGGTGTTGGGAGG + Intergenic
1041265715 8:56062569-56062591 TGTATTCTGCTGTTGTTGGATGG - Intergenic
1042330229 8:67572256-67572278 CCTAATGTGGTGGTGTTGGGAGG + Intronic
1042628358 8:70786240-70786262 TGTATTCTGCTGCTGTTGGATGG + Intronic
1043210186 8:77504310-77504332 CCAAGTGTGGTGGTGTTGGAAGG - Intergenic
1043881164 8:85544696-85544718 TCTACTATGCTGGTGGGGGAAGG + Intergenic
1044059839 8:87622640-87622662 TTTAATTTGCTGTTGTTGGCTGG + Intergenic
1044231578 8:89785068-89785090 CCCAATGTGGTGGTGTTGGGAGG - Intronic
1046245087 8:111548941-111548963 ACTAATGTGATGGTGTTAGGAGG - Intergenic
1047118181 8:121869169-121869191 ACTACAGGGCTGGTGTTGGAGGG + Intergenic
1047173927 8:122522494-122522516 CCCAATGTGGTGGTGTTGGAGGG + Intergenic
1047621750 8:126614910-126614932 CCCAATGTGGTGGTGTTGGGAGG + Intergenic
1048485370 8:134843079-134843101 ACTGATGTGATGGTGTTTGAAGG + Intergenic
1048648436 8:136448374-136448396 CCCAATGTGATGGTGTTTGAAGG - Intergenic
1048763684 8:137824524-137824546 TCCAATGTGATGGTATTTGAAGG + Intergenic
1049976187 9:862571-862593 TCTTGTGTGGTGGTGTTTGAAGG + Intronic
1050050547 9:1596508-1596530 CCTAATGTGATGGTATTAGAAGG - Intergenic
1050684920 9:8157656-8157678 GCTAATGGGCTGGTGTTTGTTGG - Intergenic
1051114938 9:13683828-13683850 CCTAATGTGATGGTGTTTGGAGG - Intergenic
1052694113 9:31854313-31854335 GCTTGTGTGCTGGTGGTGGAGGG - Intergenic
1053723040 9:40968451-40968473 TATATTCTGCTGCTGTTGGATGG + Intergenic
1053752486 9:41270138-41270160 TATATTCTGCTGTTGTTGGATGG - Intergenic
1054258011 9:62834470-62834492 TATATTCTGCTGTTGTTGGATGG - Intergenic
1054760097 9:68997059-68997081 TCTGATGGGCAGCTGTTGGACGG + Intronic
1056742548 9:89271771-89271793 TATATTTTGCTGCTGTTGGATGG + Intergenic
1058251283 9:102698425-102698447 TCCAATGTAATAGTGTTGGAAGG + Intergenic
1058512431 9:105734406-105734428 TGTATTTTGCTGTTGTTGGATGG + Intronic
1059630006 9:116111322-116111344 ACTAATGTGATGGTATTAGATGG + Intergenic
1059705452 9:116819109-116819131 TGTAATGTGCTGTGGATGGAAGG + Intronic
1060235614 9:121860567-121860589 TCCAATGTGATGGTGTTAGGAGG + Intronic
1202800765 9_KI270719v1_random:173908-173930 TATATTCTGCTGTTGTTGGATGG + Intergenic
1185842575 X:3406414-3406436 TCCAAGGTGATGGTGTTGGGAGG + Intergenic
1186504632 X:10081353-10081375 TCTAATGTGATGGCATTTGAAGG - Intronic
1186786227 X:12958115-12958137 TCTTATATGCTGTTGTTGGAAGG - Intergenic
1186946816 X:14577725-14577747 TCCAATGTGATAGTATTGGAGGG - Intronic
1187223266 X:17350756-17350778 TGTATTTTGCAGGTGTTGGATGG + Intergenic
1187743385 X:22381465-22381487 TGTATTCTGCTGCTGTTGGATGG + Intergenic
1188456938 X:30377897-30377919 TGTATTCTGCTGTTGTTGGATGG + Intergenic
1189068356 X:37836243-37836265 ACCAATGTGATGGTGTTGGGAGG + Intronic
1189478098 X:41372418-41372440 TATATTCTGCTGTTGTTGGATGG - Intergenic
1190033668 X:46999308-46999330 CCCAATGTGATGGTGTTGGGAGG - Intronic
1191957022 X:66653522-66653544 TGTATTCTGCTGCTGTTGGATGG - Intergenic
1192715103 X:73631998-73632020 TGTATTCTGCTGTTGTTGGATGG + Intronic
1193448248 X:81633311-81633333 TGTACTCTGCTGCTGTTGGATGG + Intergenic
1193932014 X:87564840-87564862 TGTAATCTCCTGTTGTTGGATGG - Intronic
1195250501 X:103040261-103040283 TATATTCTGCTGCTGTTGGACGG + Intergenic
1195502124 X:105613636-105613658 TTTAATGAGCTTGTGGTGGATGG - Intronic
1196003660 X:110812748-110812770 CCCAATGTGGTGGTGTTGGGAGG + Intergenic
1196241119 X:113344279-113344301 TATATTCTGCTGGTTTTGGATGG + Intergenic
1196381416 X:115094412-115094434 TGTATTCTGCTGCTGTTGGATGG - Intergenic
1196393843 X:115238492-115238514 CTTAATGTGGTTGTGTTGGAAGG + Intergenic
1196972353 X:121123615-121123637 CCCAATGTGGTGGTGTTGGGAGG + Intergenic
1197125071 X:122934914-122934936 TGTATTGTGCTGCTATTGGATGG - Intergenic
1197367177 X:125578572-125578594 TCTACTGTGGAGGTGTTGGGAGG - Intergenic
1198220428 X:134595314-134595336 TGTATTCTGCTTGTGTTGGATGG + Intronic
1198405792 X:136311203-136311225 TCTAATGTGTTGGTATTTGAAGG - Intronic
1198652806 X:138882343-138882365 TTTATTCTGCTGTTGTTGGATGG + Intronic