ID: 1003134450

View in Genome Browser
Species Human (GRCh38)
Location 6:3423566-3423588
Sequence CTGTAAGTTAAAAAGGAAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 857
Summary {0: 1, 1: 0, 2: 8, 3: 48, 4: 800}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1003134445_1003134450 6 Left 1003134445 6:3423537-3423559 CCTCTAAGAAAGGAAATTAAGAG 0: 1
1: 0
2: 1
3: 33
4: 396
Right 1003134450 6:3423566-3423588 CTGTAAGTTAAAAAGGAAGGAGG 0: 1
1: 0
2: 8
3: 48
4: 800
1003134443_1003134450 18 Left 1003134443 6:3423525-3423547 CCTCATCAACTACCTCTAAGAAA 0: 1
1: 0
2: 2
3: 17
4: 332
Right 1003134450 6:3423566-3423588 CTGTAAGTTAAAAAGGAAGGAGG 0: 1
1: 0
2: 8
3: 48
4: 800
1003134442_1003134450 19 Left 1003134442 6:3423524-3423546 CCCTCATCAACTACCTCTAAGAA 0: 1
1: 0
2: 1
3: 12
4: 163
Right 1003134450 6:3423566-3423588 CTGTAAGTTAAAAAGGAAGGAGG 0: 1
1: 0
2: 8
3: 48
4: 800

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1003134450 Original CRISPR CTGTAAGTTAAAAAGGAAGG AGG Intronic
901845805 1:11981202-11981224 ATGTAGTTAAAAAAGGAAGGAGG + Intronic
902024843 1:13375193-13375215 CTGGAAGTTGATAAGGGAGGTGG - Intergenic
903416229 1:23185094-23185116 CTGTTAATAAAAAAGGCAGGAGG + Intergenic
904556019 1:31364962-31364984 CTGTAAGTTACCCAGGAAGAAGG - Intergenic
904671858 1:32171903-32171925 CTGTAAGTTGCAGAGGAGGGTGG + Exonic
904720636 1:32505185-32505207 GGGTAATTTAAAAAGGAAAGAGG - Intronic
904802611 1:33105429-33105451 GGGTAATTTAAAAAGGAAAGAGG + Intronic
906791611 1:48663242-48663264 CTGTAAGATAAAATGAAAGATGG + Intronic
907827151 1:58029497-58029519 CTGTACCTTAAAAGGGGAGGGGG + Intronic
908090905 1:60684997-60685019 GTGTAATTTATAAAGGAAAGAGG - Intergenic
908133261 1:61099086-61099108 CTGTAGTTTAAAAATGTAGGTGG - Intronic
908570312 1:65402849-65402871 CAGTAAGATACAAAGAAAGGTGG - Intronic
908885343 1:68781885-68781907 GTGTAATTTATAAAGGAAAGAGG - Intergenic
909378265 1:74966251-74966273 CTGAAAGTTAAGGGGGAAGGGGG - Intergenic
909405150 1:75280878-75280900 GTGTAATTTACAAAGGAAAGAGG - Intronic
909748231 1:79125856-79125878 CTGTAATTTATAAAGGAAAGAGG - Intergenic
909872007 1:80752806-80752828 CAGTAATTTATAAAGGAAAGAGG + Intergenic
910064793 1:83140455-83140477 GGGTAAATTATAAAGGAAGGAGG - Intergenic
910147659 1:84101529-84101551 ATGTAAGTTAAAAAGAAAGTAGG - Intronic
910509119 1:87983969-87983991 GTGTAATTTACAAAGGAAAGAGG - Intergenic
910536208 1:88300752-88300774 ATGTATGTAAAAAATGAAGGTGG + Intergenic
911041597 1:93595289-93595311 TTGTATTTTAAAAGGGAAGGAGG + Intronic
911425873 1:97711420-97711442 CTGAAAGTTAAAAATAAAGTAGG + Intronic
911482292 1:98459365-98459387 GGGTAGGTTAAAGAGGAAGGGGG + Intergenic
911554944 1:99332091-99332113 CAGTAATTTATAAAGGAAAGAGG - Intergenic
911586646 1:99698699-99698721 GGGTAATTTATAAAGGAAGGAGG + Intergenic
912084168 1:105977948-105977970 CAGTAACTTATAAAGGAAAGAGG - Intergenic
912147172 1:106808514-106808536 GTGTAATTTATAAAGGAAAGAGG + Intergenic
912467112 1:109881893-109881915 CTGTCTGTTCAAAAGGATGGGGG - Intergenic
912934081 1:113987623-113987645 GGGTAATTTATAAAGGAAGGGGG + Intergenic
913094359 1:115502482-115502504 GGGTAATTTATAAAGGAAGGAGG - Intergenic
913481037 1:119289424-119289446 GTGTAATTTATAAAGGAAAGAGG - Intergenic
914045942 1:144092389-144092411 ATTTAAGTTAAAAAGGGCGGGGG + Intergenic
914132168 1:144868298-144868320 ATTTAAGTTAAAAAGGGCGGGGG - Intergenic
915008978 1:152666911-152666933 ATATAAGTTAAGAATGAAGGGGG + Intergenic
916147613 1:161754495-161754517 GGGTAATTTATAAAGGAAGGAGG + Intronic
916261241 1:162844445-162844467 TGGCAAGTTAAAAGGGAAGGAGG - Intronic
916424006 1:164663338-164663360 ATGGAAGGAAAAAAGGAAGGAGG - Intronic
916573189 1:166045128-166045150 CTGTAAGTTAGAGATGATGGGGG + Intergenic
916856379 1:168754539-168754561 TTTTAAGTTAAAAAAGAAGTAGG - Intergenic
917051782 1:170932514-170932536 CTGGAACTTAAAAAGGGAAGCGG - Intergenic
917073772 1:171181960-171181982 CAGAAAGTTAAAAATGAAGGAGG + Intergenic
917458402 1:175205615-175205637 CAGTAATTTCAAAAGGGAGGAGG + Intergenic
917705100 1:177624491-177624513 CTGTAATTTATAAAGAAAAGAGG + Intergenic
918358160 1:183725305-183725327 CAGTAATTTATAAAGGAAAGAGG + Intronic
918613761 1:186521156-186521178 GTGTAATTTATAAAGGAAGAAGG - Intergenic
918706264 1:187666678-187666700 CTATAAATTAAAAAAAAAGGGGG - Intergenic
919128640 1:193427047-193427069 GGGTAATTTATAAAGGAAGGAGG + Intergenic
920246346 1:204590381-204590403 GGGTAAGTTACAAAGAAAGGAGG + Intergenic
920800663 1:209184329-209184351 GAGTAATTTAAAAAGGAAAGAGG - Intergenic
921835849 1:219777407-219777429 CGGTAATTTACAAAGGAAAGAGG - Intronic
922160527 1:223076496-223076518 CTGTATATTCCAAAGGAAGGAGG - Intergenic
922205566 1:223443311-223443333 GGGTAATTTATAAAGGAAGGAGG - Intergenic
923339413 1:232994921-232994943 GTGTAATTTACAAAGGAAGGAGG - Intronic
923917312 1:238523638-238523660 CTGTAATTTATAAAAGAAAGAGG + Intergenic
924247699 1:242100783-242100805 CTGTAAGAAAAAAAAAAAGGGGG + Intronic
924261450 1:242235591-242235613 CTGTATGTTATAAAGGAGAGTGG + Intronic
924299402 1:242621995-242622017 CAGCAAGTTAAAAAGGAGTGTGG - Intergenic
924936769 1:248778406-248778428 TGGTAATTTAGAAAGGAAGGAGG - Intergenic
1063152460 10:3349611-3349633 CTGGAAGAAAAAAAGGAATGCGG + Intergenic
1063505864 10:6599091-6599113 GGGTAATTTATAAAGGAAGGGGG - Intergenic
1063789992 10:9433723-9433745 TTGTAGGTTCAAAAGGAAAGGGG - Intergenic
1063809133 10:9682711-9682733 GTGTAATTTATAAAGGAAAGAGG - Intergenic
1063827964 10:9920192-9920214 GTGTAATTTATAAAGGAAAGAGG - Intergenic
1064361168 10:14666223-14666245 GGGTAATTTAAAAAGGAAAGAGG + Intronic
1064460559 10:15531258-15531280 GAGAAAATTAAAAAGGAAGGAGG - Intronic
1064686606 10:17868240-17868262 GGGTAATTTAAAAAGGAAAGAGG + Intronic
1065013973 10:21444469-21444491 GTGGAAGTTGAAAAGGAAGCAGG - Intergenic
1065106305 10:22390046-22390068 CTGTATGTTAAACAGAAATGTGG + Intronic
1065115661 10:22480278-22480300 GTGGAAGGTAAAAAGGAAGCAGG - Intergenic
1065440907 10:25752610-25752632 GGGTAATTTATAAAGGAAGGAGG - Intergenic
1065502290 10:26394206-26394228 GGGTAATTTATAAAGGAAGGAGG + Intergenic
1065753321 10:28908404-28908426 GTGTAATTTATAAAGGAAAGAGG - Intergenic
1066680961 10:37936760-37936782 CTATAAGTCAAAAAGGAAGGGGG + Intergenic
1067433467 10:46261146-46261168 GGGTAAGTTACAAAGGAAGGAGG - Intergenic
1068244036 10:54341482-54341504 GTGTAATTTACAAAGAAAGGAGG - Intronic
1068521896 10:58085969-58085991 GTGGAAGGTCAAAAGGAAGGAGG - Intergenic
1068731000 10:60357740-60357762 CTGGAAGTGAAAAATGAAGAGGG - Intronic
1069195092 10:65541877-65541899 CAGTAAGTCAGAAAGGAAGATGG - Intergenic
1069540025 10:69287132-69287154 GGGTAATTTAAAAAGGAAAGAGG + Intronic
1070415115 10:76182114-76182136 GGGTAATTTATAAAGGAAGGAGG + Intronic
1070456349 10:76621038-76621060 GTGTAATTTATAAAGGAAAGAGG + Intergenic
1071099249 10:82015677-82015699 CGGTAATTTATAAAGGAAAGAGG - Intronic
1071370417 10:84945519-84945541 GTGTATGTTCAAAAGTAAGGGGG + Intergenic
1072094945 10:92169101-92169123 CAGTAATTTATAAAGGAAAGAGG - Intronic
1072304872 10:94097505-94097527 CTGGAAGCTCAAAGGGAAGGAGG - Intronic
1072389863 10:94972310-94972332 CTCTAAGAGAAACAGGAAGGAGG - Intronic
1072559892 10:96562381-96562403 ATGTAATTTAAAAAGAAAAGAGG - Intronic
1072909149 10:99484575-99484597 ATGAATGTTAAACAGGAAGGGGG - Intergenic
1074208058 10:111301695-111301717 GTGTAATTTATAAAGGAAAGAGG - Intergenic
1074369138 10:112885130-112885152 CAGTAATTTATAAAGGAAAGAGG - Intergenic
1074882668 10:117670848-117670870 CGGTAATTTATAAAGGAAAGAGG + Intergenic
1075059198 10:119242892-119242914 GGGTAATTTATAAAGGAAGGGGG - Intronic
1075830374 10:125405513-125405535 CAAAAAGTTAAAAAGCAAGGAGG - Intergenic
1076108406 10:127843082-127843104 GTGTAATTTATAAAGGAAAGAGG - Intergenic
1076271224 10:129153709-129153731 CTGTAAGATTTAAAGGATGGTGG - Intergenic
1076902057 10:133344433-133344455 GGGAAAGTGAAAAAGGAAGGGGG + Intronic
1077667883 11:4131066-4131088 GGGTAATTTAAAAAGGAAAGAGG + Intronic
1077937573 11:6804348-6804370 ACTTAAGTTAAAAAGGAAGGAGG + Intergenic
1078153705 11:8780112-8780134 CTGTAAGTATGAATGGAAGGAGG - Intronic
1078452023 11:11447554-11447576 GGGTAATTTATAAAGGAAGGAGG + Intronic
1079065556 11:17288251-17288273 TTGTAAGTGAAAAAGCACGGTGG + Intronic
1079084925 11:17438439-17438461 CTGGATGTTAAAGAGGAAGCAGG - Intronic
1079166151 11:18045479-18045501 CTGTTAGTTAAAAAAAAAAGGGG - Intergenic
1080221517 11:29910819-29910841 CTGTAAGTTGAGGAGCAAGGAGG - Intergenic
1080878773 11:36300354-36300376 CTGTAAGTTCACAAGAAAGCTGG - Intronic
1080946228 11:36978466-36978488 CTGTAAAATAAAAAGCAAGTTGG + Intergenic
1081309950 11:41557906-41557928 TTGTAATTTATAAAGGAAAGAGG - Intergenic
1081348967 11:42025950-42025972 GTGTAATTTATAAAGGAAAGAGG + Intergenic
1081407666 11:42716301-42716323 GTGTGTGTTAAAAAGAAAGGAGG - Intergenic
1081414727 11:42800812-42800834 GAGTAATTTAAAAAGGAAAGAGG + Intergenic
1082616947 11:55372306-55372328 CTGTAATTTATAAAGAAAAGAGG + Intergenic
1083107116 11:60368832-60368854 GTGTAATTTATAAAGGAAAGAGG - Intronic
1083458082 11:62792183-62792205 CTTTATATTAAAAAGTAAGGAGG + Exonic
1083688190 11:64390304-64390326 CTGTAATTTACAAAGGAAAAAGG + Intergenic
1083725335 11:64625113-64625135 ATCTAAGGCAAAAAGGAAGGAGG + Intronic
1084221565 11:67683637-67683659 CAGTAAGTCCAAAAGGGAGGAGG - Intergenic
1084479958 11:69414293-69414315 GGGTAATTTATAAAGGAAGGAGG - Intergenic
1084551392 11:69845107-69845129 CTGTTACTAAAGAAGGAAGGGGG - Intergenic
1085068387 11:73519055-73519077 CTGTAATTTATAAAGAAAAGGGG - Intronic
1085291879 11:75406621-75406643 TTATGAGTCAAAAAGGAAGGGGG - Intronic
1085453538 11:76653343-76653365 CTGTCAGCTAAGACGGAAGGAGG - Intergenic
1085667672 11:78429835-78429857 CTGTAAGGCAGATAGGAAGGAGG + Intergenic
1085705579 11:78784365-78784387 CTGTAGGATATAAGGGAAGGGGG - Intronic
1086765732 11:90693103-90693125 GGGTAAGTTATAAAGGAAAGAGG - Intergenic
1086935944 11:92746207-92746229 CAGTAATTTATAAAGGAAAGAGG + Intronic
1087621561 11:100548861-100548883 CTGTCTGTAAACAAGGAAGGGGG - Intergenic
1088114293 11:106298260-106298282 CTGTAAGTTGAATGGGAAGATGG + Intergenic
1088157171 11:106821090-106821112 CTGTGATTTAAAAAGAAAAGTGG - Intronic
1088611131 11:111578135-111578157 GGGTAATTTATAAAGGAAGGAGG - Intergenic
1088691899 11:112335560-112335582 CTCTAAGGTGCAAAGGAAGGTGG - Intergenic
1089864977 11:121623891-121623913 GGGTAATTTATAAAGGAAGGAGG + Intronic
1089935870 11:122363460-122363482 CTGTAAGACCAAATGGAAGGAGG - Intergenic
1091156332 11:133377549-133377571 CTGGGAGTTCAAAGGGAAGGTGG - Intronic
1092268435 12:7001776-7001798 ATGTTAGTGAAAAAGGAAGAGGG - Intronic
1092312346 12:7371180-7371202 GGGTAATTTATAAAGGAAGGAGG - Intronic
1092646019 12:10572824-10572846 CTTTAAATGAAAAAGGAAAGAGG + Intergenic
1092898910 12:13040321-13040343 CTGTAATTTACAAAGGCATGGGG + Intergenic
1093014633 12:14143931-14143953 GTGTAATTTATAAAGGAAAGAGG + Intergenic
1093252104 12:16819488-16819510 ATGTAACTTATAAAGGAAAGAGG + Intergenic
1093550489 12:20404412-20404434 CTGTAGGTTAAAAAAGAAAAGGG + Intronic
1093879204 12:24384131-24384153 GGGTAATTTATAAAGGAAGGAGG - Intergenic
1094090535 12:26644482-26644504 CGGTAACTTATAAAGGAAAGAGG + Intronic
1094153568 12:27313278-27313300 GTGTAATTTATAAAGGAAAGAGG + Intronic
1095295433 12:40521954-40521976 CTGTGAGTGAAAAAGCAATGTGG - Intronic
1095297359 12:40542251-40542273 CTGTGAGATAGAAAGGAGGGGGG - Intronic
1095349830 12:41196210-41196232 CTGTAAGATAAAAAGTAAGGAGG + Intronic
1095425385 12:42069518-42069540 GGGTAATTTAAAAAGGAAAGAGG + Intergenic
1095749225 12:45693159-45693181 GGGTAAGTTACAAAGGAAAGAGG + Intergenic
1096316560 12:50572289-50572311 ATGTAATTTTAAAAGGGAGGAGG - Intronic
1096401064 12:51306823-51306845 CTATAAATGAAAAAGCAAGGAGG - Intronic
1097319669 12:58211264-58211286 GGGTAATTTATAAAGGAAGGAGG + Intergenic
1097492840 12:60291685-60291707 GTGTAATTTATAAAGAAAGGTGG - Intergenic
1097600152 12:61681447-61681469 GGGTAATTTAAAAAGGAAAGAGG - Intergenic
1097605327 12:61746351-61746373 GGGTAATTTATAAAGGAAGGAGG - Intronic
1098664462 12:73144047-73144069 CTGTGAGTTTAAAATGAAAGTGG + Intergenic
1098694082 12:73529111-73529133 GAGTAATTTATAAAGGAAGGAGG - Intergenic
1098824722 12:75281424-75281446 CTGCAAGATAAAAAATAAGGTGG + Intronic
1099356761 12:81646568-81646590 CTGAAAGTTAAAAATGGAAGAGG + Intronic
1099826815 12:87786229-87786251 GTGTAATTTATAAAGGAAAGAGG - Intergenic
1100174296 12:92011935-92011957 CAGAAAGGAAAAAAGGAAGGAGG + Intronic
1100262359 12:92944769-92944791 CTGTGAGGTAAAAAGTAATGAGG + Intergenic
1100428353 12:94508426-94508448 GGGTAAGTTATAAAGGAAAGAGG + Intergenic
1100759898 12:97795930-97795952 GGGTAATTTAAAAAGGAAAGAGG + Intergenic
1100826264 12:98477398-98477420 GGGTAATTTAAAAAGGAAAGAGG - Intergenic
1100946265 12:99787434-99787456 TTGTAATTTATAAAGGAAAGAGG - Intronic
1101147677 12:101856345-101856367 GTGTAATTTATAAAGGAAAGAGG - Intergenic
1101190316 12:102325890-102325912 GGGTAATTTATAAAGGAAGGAGG - Intergenic
1101294308 12:103405133-103405155 CTGTTATTTAAAAAGGAGGAGGG + Intronic
1101582018 12:106050038-106050060 GTTTAATTTATAAAGGAAGGAGG + Intergenic
1101692933 12:107097907-107097929 GGGTAATTTATAAAGGAAGGAGG - Intergenic
1102799942 12:115723393-115723415 CTGAAAGTTCAAAGGCAAGGAGG - Intergenic
1104367015 12:128187221-128187243 TGGTAAGTTATAAAGGAAAGAGG - Intergenic
1105657598 13:22457621-22457643 GTGTAATTTATAAAGGAAAGAGG + Intergenic
1105764107 13:23541532-23541554 CTAAAAATTAAAGAGGAAGGAGG - Intergenic
1106070809 13:26409062-26409084 CAGCAAGTTAAAAAAGAGGGAGG - Intergenic
1106633675 13:31504523-31504545 GGGTAAGTTATAAAGGAAGGAGG - Intergenic
1107115641 13:36742769-36742791 GTGTAAGGTGAAGAGGAAGGGGG - Intergenic
1107347806 13:39481669-39481691 CTGTAACACAAAAAGGAAGGGGG + Intronic
1107791002 13:44002228-44002250 TTGTTAGTGAAACAGGAAGGAGG - Intergenic
1107862104 13:44670735-44670757 GGGTAATTTAAAAAGGAAAGAGG + Intergenic
1108103118 13:46979092-46979114 GGGTAATTTATAAAGGAAGGAGG + Intergenic
1108154747 13:47573730-47573752 GTGTAATTTATAAAGGAAAGAGG - Intergenic
1108328614 13:49360919-49360941 GAGTAATTTAAAAAGGAAAGGGG - Intronic
1108891476 13:55266063-55266085 GGGTAATTTATAAAGGAAGGAGG + Intergenic
1108908790 13:55515935-55515957 GGGTAATTTATAAAGGAAGGAGG - Intergenic
1109189382 13:59307135-59307157 GGGTAATTTAAAAAGGAAAGAGG + Intergenic
1109893804 13:68655539-68655561 CAGTAATTTACAAAGGAAAGAGG + Intergenic
1109895196 13:68677467-68677489 GTGTAATTTATAAAGGAAAGAGG - Intergenic
1110150497 13:72246932-72246954 CTGTACTTTAAAAAGAAAGCAGG + Intergenic
1110382628 13:74871714-74871736 ATGTAAGTCAACAAGGAAGATGG - Intergenic
1111038015 13:82704829-82704851 GGGTAATTTAAAAAGGAAAGAGG + Intergenic
1111263511 13:85775552-85775574 GGGTAATTTAAAAAGGAAAGAGG - Intergenic
1111619309 13:90703404-90703426 CGGTAATTTATAAAGGAAAGAGG + Intergenic
1111620716 13:90721753-90721775 GGGTAATTTATAAAGGAAGGAGG - Intergenic
1111688338 13:91528712-91528734 CAGTAACTTAGAAAGGAAAGAGG + Intronic
1111827477 13:93286076-93286098 GCGTAATTTACAAAGGAAGGAGG + Intronic
1111836245 13:93391885-93391907 TTGACAGTTAAAAAGGATGGGGG + Intronic
1112161521 13:96873197-96873219 AGGTAATTTATAAAGGAAGGAGG - Intergenic
1112289266 13:98130623-98130645 CTTCAAGCTAAAACGGAAGGAGG + Intergenic
1112391918 13:98992741-98992763 CTGTAATTTATAAAGGAAAGAGG - Intronic
1112694528 13:101932733-101932755 CTGTAATTTTAAAAGGGAGAGGG - Intronic
1112789650 13:102988810-102988832 GGGTAATTTATAAAGGAAGGAGG + Intergenic
1112855674 13:103767425-103767447 GGGTAATTTACAAAGGAAGGAGG + Intergenic
1112942959 13:104888600-104888622 GGGTAATTTAAAAAGGAAAGAGG - Intergenic
1113221977 13:108115002-108115024 CTGTAATTTATAAAGAAAAGAGG - Intergenic
1113225743 13:108158180-108158202 GTGTAATTTATAAAGGAAAGAGG + Intergenic
1113355912 13:109579950-109579972 CTGTAAGTAAAAAATGAAAAGGG - Intergenic
1114206932 14:20580966-20580988 CTGAACGGTAAAATGGAAGGAGG - Intergenic
1114455597 14:22851342-22851364 CTGTAAGTCACAAAGGAATAAGG - Intergenic
1115005843 14:28483587-28483609 CTGTAAAGTAAAAAGGAAATTGG + Intergenic
1115134687 14:30094725-30094747 GGGTAATTTATAAAGGAAGGAGG - Intronic
1115953115 14:38744259-38744281 GGGTAATTTATAAAGGAAGGAGG + Intergenic
1116399395 14:44487314-44487336 CTGTAATTTATAAAGAAAGGAGG + Intergenic
1116781024 14:49237352-49237374 GGGTAATTTATAAAGGAAGGAGG - Intergenic
1117085373 14:52195493-52195515 AGGTAAGTTATAAAGGAAAGAGG - Intergenic
1117395959 14:55311084-55311106 CTGTAATTTATAAAGGAAAGAGG + Intronic
1117667332 14:58070288-58070310 CTTTGAGTCAAAAAGGAAGGTGG + Intronic
1117987434 14:61401372-61401394 CTGTAAGTGAAAAAACTAGGTGG + Intronic
1119987300 14:79152506-79152528 CGGTAATTTATAAAGGAAAGAGG + Intronic
1120610949 14:86640667-86640689 CTGTAATTTATAAAGAAAAGAGG - Intergenic
1121043280 14:90768237-90768259 GTGTAATTTATAAAGGAAAGAGG + Intronic
1121057382 14:90869520-90869542 CAGTAAGTGAAGAAGGGAGGGGG + Exonic
1121514084 14:94537567-94537589 GGGTAATTTATAAAGGAAGGAGG + Intergenic
1121689703 14:95868494-95868516 CTCTAAATGAATAAGGAAGGAGG - Intergenic
1121704882 14:95984038-95984060 CTGTAAGGAAAGGAGGAAGGAGG - Intergenic
1122014377 14:98781633-98781655 CTGCAAGGTGAAAAGGAAAGAGG - Intergenic
1122171163 14:99876768-99876790 CTGTAAGCAAAAAAGGAGGAGGG - Intronic
1123064798 14:105612258-105612280 GAGTAAGTTATAAAGGAAAGAGG - Intergenic
1124903100 15:33842705-33842727 CTGTAACTTGGAAAGGAATGAGG + Intronic
1124973139 15:34509921-34509943 CTGTAAGTTAAAATGGCAAAGGG - Intergenic
1126844491 15:52746207-52746229 GAGTAATTTATAAAGGAAGGAGG - Intergenic
1126856842 15:52847222-52847244 GTGTAATTTACAAAGGAAGGAGG + Intergenic
1126917683 15:53484032-53484054 CTGAAAGTTAAAAATGAGTGGGG + Intergenic
1127245084 15:57164322-57164344 GTGTAATTTATAAAGGAAAGAGG + Intronic
1127318721 15:57821401-57821423 GGGTAATTTATAAAGGAAGGAGG + Intergenic
1128200286 15:65799458-65799480 CTGTATGCTAAAAGGGAATGGGG + Intronic
1128808618 15:70553699-70553721 GTGTAAAATGAAAAGGAAGGTGG + Intergenic
1128924781 15:71645226-71645248 CTGCAATTTATAAAGGAAAGAGG + Intronic
1129080027 15:73031545-73031567 TTTTGAATTAAAAAGGAAGGAGG + Intergenic
1129590402 15:76909796-76909818 GGGTAATTTATAAAGGAAGGAGG - Intergenic
1129803051 15:78431047-78431069 CTGGAAGTCAGAAATGAAGGTGG + Intergenic
1129900175 15:79141724-79141746 CAGTAATTTATAAAGGAAAGAGG + Intergenic
1130420953 15:83746403-83746425 CTGTTAGCAAAAAAGAAAGGAGG + Intronic
1130441790 15:83962250-83962272 GGGTAAGTTATAAAGGAAAGAGG - Intronic
1130677150 15:85963103-85963125 GGGTAATTTATAAAGGAAGGTGG + Intergenic
1130805897 15:87321639-87321661 CTGTAATTTAATAAGGAGGCAGG + Intergenic
1131630140 15:94167484-94167506 GGGTAATTTATAAAGGAAGGAGG - Intergenic
1131665188 15:94564107-94564129 CTGTAATTTATAAAGAAAAGAGG + Intergenic
1132072193 15:98788106-98788128 CTCTAAGTTAATAAAGAATGTGG + Intronic
1132312156 15:100865066-100865088 CTGTCAGTCAAGAAGAAAGGGGG - Intergenic
1132530923 16:448981-449003 CTGAAATTTAAAAAGTAAGATGG + Intronic
1134763890 16:16738894-16738916 GTGTAATTTATAAAGGAAAGAGG - Intergenic
1134801731 16:17090844-17090866 GGGTAATTTATAAAGGAAGGGGG - Intergenic
1134982165 16:18620269-18620291 GTGTAATTTATAAAGGAAAGAGG + Intergenic
1135645488 16:24157887-24157909 CGGTAATTTATAAAGGAAAGGGG - Intronic
1136036511 16:27544575-27544597 CTGCAAGTCAAGAAAGAAGGTGG + Intronic
1137377284 16:47963439-47963461 CTGTAATTTAAAAATTATGGAGG + Intergenic
1138384127 16:56624990-56625012 CTTTAAATTAAAAAGCAAGGTGG - Intergenic
1138385179 16:56631854-56631876 CTTTAAATTAAAAAGCAAGATGG - Intergenic
1138385759 16:56634945-56634967 CTTTAAATTAAAAAGCAAGATGG - Intergenic
1138494084 16:57396648-57396670 CTGTTTGTTAAGCAGGAAGGAGG + Intergenic
1138821114 16:60261398-60261420 GGGTAATTTATAAAGGAAGGAGG + Intergenic
1138893556 16:61175223-61175245 GGGTAATTTAAAAAGGAAAGAGG - Intergenic
1139128629 16:64113393-64113415 CGGTAATTTATAAAGGAAAGAGG + Intergenic
1139164174 16:64546614-64546636 GTGTAATTTATAAAGGAAAGAGG + Intergenic
1139760329 16:69179825-69179847 GTGTAATTTCATAAGGAAGGAGG - Intronic
1139762693 16:69199378-69199400 CTGCTAGTTAAAATGAAAGGTGG - Intronic
1140576789 16:76180175-76180197 GGGTAATTTATAAAGGAAGGAGG + Intergenic
1140898993 16:79350976-79350998 CTGCAAGTGAAAAAAGAATGTGG - Intergenic
1140917399 16:79506553-79506575 CTGGTAGATAAAAAGGAAGACGG + Intergenic
1140963302 16:79938644-79938666 CTGTCAAATAAAAAGGAAGCTGG - Intergenic
1140966252 16:79968991-79969013 GGGTAATTTAAAAAGGAAAGAGG + Intergenic
1141061195 16:80872707-80872729 CTGTATTTTAAAAAGGAAAAGGG + Intergenic
1141263840 16:82477768-82477790 GGGTAATTTAAAAAGGAAAGAGG + Intergenic
1141316233 16:82964967-82964989 CTGGGAGCTAAGAAGGAAGGTGG + Intronic
1142471807 17:168885-168907 GTGTAATTTATAAAGGAAAGAGG - Intronic
1142532270 17:588579-588601 CTGAAAGGTAAAAAGGGAAGAGG - Intronic
1143263626 17:5619294-5619316 GGGTAATTTATAAAGGAAGGAGG + Intronic
1145757729 17:27404962-27404984 GTGTAACTTACAAAGGAAAGAGG + Intergenic
1146011667 17:29199466-29199488 CTGAAAGTTAAGGAGGAAGAAGG - Intergenic
1146537391 17:33664688-33664710 CTGCAAGTTAAAGAAGAGGGGGG - Intronic
1147986720 17:44311173-44311195 CTCCAAGTTCAAAAGGAAGGGGG + Intronic
1148966921 17:51443425-51443447 CTGTAAGGAGAAAAGGGAGGTGG + Intergenic
1149862935 17:60134138-60134160 GGGTAAGTTAGAAAGGAAAGAGG + Intergenic
1150430351 17:65110693-65110715 CTGCAAGACAAAAAAGAAGGAGG - Intergenic
1150472424 17:65448474-65448496 CTGTAAGATAAGAATGAGGGTGG + Intergenic
1150998241 17:70343777-70343799 AGGAAAGATAAAAAGGAAGGAGG + Intergenic
1151222964 17:72626974-72626996 CTGTAATTTATAAAGAAAAGAGG - Intergenic
1151269106 17:72979298-72979320 GGGTAATTTATAAAGGAAGGAGG - Intronic
1152003575 17:77662697-77662719 CTGGAAGTTCAAGATGAAGGTGG - Intergenic
1153142663 18:1992231-1992253 GGGTAATTTATAAAGGAAGGAGG - Intergenic
1153835114 18:8956783-8956805 CAGTAGGTGAAAGAGGAAGGAGG - Intergenic
1153851784 18:9102327-9102349 CTGTTAGTTAAAAATAAAGTCGG - Intergenic
1154987419 18:21566207-21566229 CTGTAATTTAATCAAGAAGGTGG + Intronic
1155629362 18:27873985-27874007 TTGTAAGGTAAAAAGCAAAGGGG - Intergenic
1155685048 18:28538316-28538338 CGGTAATTTATAAAGGAAAGAGG + Intergenic
1155900172 18:31379642-31379664 TTGGAAGTTAAAAAGGTAGGTGG + Intronic
1155968166 18:32055413-32055435 GGGTAATTTAGAAAGGAAGGAGG + Intronic
1156840667 18:41606493-41606515 AGGTAATTTATAAAGGAAGGAGG + Intergenic
1157768117 18:50318187-50318209 CAGTAATTTACATAGGAAGGAGG - Intergenic
1158313389 18:56183647-56183669 CTGTAATTTATAAAAGAAAGAGG - Intergenic
1158595213 18:58810063-58810085 GTGTAATTTATAAAGGAAAGAGG + Intergenic
1158640101 18:59196367-59196389 CTGGAAGTTCAAAGGGAAGCAGG - Intergenic
1158786553 18:60720568-60720590 GGGTAATTTATAAAGGAAGGAGG + Intergenic
1159070000 18:63612842-63612864 GGGTAATTTAAAAAGGAAAGGGG + Intergenic
1159111034 18:64056816-64056838 GTGTAATTTATAAAGGAAAGAGG - Intergenic
1159357919 18:67359879-67359901 GGGTAATTTATAAAGGAAGGAGG - Intergenic
1159432754 18:68376730-68376752 GTGCAAGTTAAAAGGGAAGTAGG + Intergenic
1159626111 18:70696626-70696648 GTGTAATTTATAAAGGAAAGAGG - Intergenic
1159710659 18:71754903-71754925 CAAGAAGTTAGAAAGGAAGGTGG + Intronic
1159716494 18:71830194-71830216 ATTTAAGTTAAAAAGGCAAGTGG + Intergenic
1159718489 18:71855612-71855634 GTGTAATTTATAAAGGAAAGAGG + Intergenic
1160154076 18:76419781-76419803 GGGTAAGTTATAAAGGAAAGAGG - Intronic
1161833598 19:6629324-6629346 GTGTAATTTACAAAGAAAGGGGG + Intergenic
1161881549 19:6957924-6957946 CTGTAAGTGCAAATGGAAGGAGG - Intergenic
1162090405 19:8276058-8276080 CTGTATCTTAAAAAGGAAAAAGG - Intronic
1162092638 19:8290891-8290913 CTGTATCTTAAAAAGGAAAAAGG - Intronic
1162275454 19:9650474-9650496 CTGTATGTGAAAAGAGAAGGGGG + Intronic
1164519331 19:28966382-28966404 ATTTGAGTTCAAAAGGAAGGTGG + Intergenic
1164941267 19:32253546-32253568 CTGTAAGTTGGAAGGGAGGGAGG - Intergenic
1166114165 19:40642543-40642565 CTGTAAATAAAGAAGGAAGAGGG + Intergenic
1167198211 19:48045180-48045202 CTGTAAGGCAATTAGGAAGGAGG + Intergenic
1167198717 19:48049151-48049173 CGGTAATTTATAAAGGAAAGAGG - Intronic
1167888473 19:52521243-52521265 CTGTATGTGAAAAATGAAGGGGG - Intergenic
1202685501 1_KI270712v1_random:45802-45824 ATTTAAGTTAAAAAGGGCGGGGG + Intergenic
925450156 2:3962283-3962305 GGGTAATTTATAAAGGAAGGAGG - Intergenic
926710032 2:15871958-15871980 GGGTAATTTATAAAGGAAGGAGG - Intergenic
926819029 2:16832713-16832735 CTGTAAAATAAAAAGCAAGTTGG - Intergenic
926827044 2:16915724-16915746 ATGTTTTTTAAAAAGGAAGGAGG - Intergenic
927032451 2:19136182-19136204 CTGTCAGTTATAAATGAAGTTGG - Intergenic
927315347 2:21675097-21675119 CAGAAAGTTAAAAAAGAAAGAGG + Intergenic
927336257 2:21928123-21928145 GGGTAATTTATAAAGGAAGGAGG - Intergenic
928269500 2:29843418-29843440 CTGGAAGAAAAGAAGGAAGGAGG + Intronic
928630154 2:33183204-33183226 CTGGAAGTGAAATTGGAAGGTGG - Intronic
928633298 2:33216216-33216238 CTGTGGGGTAAAAAGGAGGGAGG + Intronic
929442773 2:41978476-41978498 GGGTAATTTATAAAGGAAGGAGG + Intergenic
929744393 2:44640999-44641021 CTGTAACATAAAAAGGAGGGAGG - Intronic
931006443 2:57855381-57855403 AGGTAATTTATAAAGGAAGGAGG + Intergenic
931786136 2:65621022-65621044 CTGAAAGCTGAAAAGGAAAGTGG - Intergenic
931795762 2:65708478-65708500 CTGTAATTTATAAAGCAAAGAGG + Intergenic
933005216 2:76983587-76983609 CTGTAATTTAAACAGGGAAGAGG - Intronic
933167136 2:79088517-79088539 GGGTAACTTAAAAAGGAAAGAGG + Intergenic
933228628 2:79779928-79779950 CAGTAATTTCAAAAGGCAGGCGG - Intronic
933426281 2:82115830-82115852 ATGGAAGGTAAAAAGCAAGGTGG + Intergenic
933547990 2:83739640-83739662 AGGTAATTTAAAAAGGAATGAGG + Intergenic
933548257 2:83741587-83741609 AGGTAATTTATAAAGGAAGGAGG + Intergenic
934246223 2:90309031-90309053 ATTTAAGTTAAAAAGGGCGGGGG - Intergenic
934262525 2:91487999-91488021 ATTTAAGTTAAAAAGGGCGGGGG + Intergenic
935188622 2:100757415-100757437 CGGTAATTTATAAAGGAAAGAGG + Intergenic
935386754 2:102507629-102507651 CTGTAATTTAAAAATGAGAGGGG - Intronic
935433370 2:103002276-103002298 CTGTATGTGAATAAGGAGGGTGG + Intergenic
935680080 2:105628486-105628508 GGGTAATTTAAAAAGGAAAGAGG + Intergenic
936224875 2:110639772-110639794 ATGAAAGTGAAAAATGAAGGAGG - Exonic
936499710 2:113056540-113056562 GTGTAATTTATAAAGGAAAGAGG + Intergenic
936689711 2:114872144-114872166 CGGTAATTTATAAAGGAAAGAGG + Intronic
936794865 2:116193308-116193330 GTGTAATTTACAAAGGAAGGAGG + Intergenic
936795104 2:116195189-116195211 GGGTAATTTATAAAGGAAGGAGG + Intergenic
936940745 2:117881999-117882021 CGGTAATTTATAAAGCAAGGAGG - Intergenic
937567434 2:123311751-123311773 ATGTAAGTTAAAAAAAAAGGAGG - Intergenic
937570429 2:123351432-123351454 GTGTAATTTATAAAGGAAAGAGG - Intergenic
937991777 2:127666670-127666692 CGGTAAATTATAAAGGAAAGAGG + Intronic
939544347 2:143534332-143534354 CGGTAATTTATAAAGGAAAGAGG - Intronic
939823012 2:146980324-146980346 GGGTAATTTATAAAGGAAGGAGG - Intergenic
939852387 2:147317498-147317520 CTGTTTGTTAAACAGGGAGGAGG - Intergenic
941034711 2:160555621-160555643 GGGTAATTTATAAAGGAAGGAGG + Intergenic
941121034 2:161530469-161530491 CAGTAATTTATAAAGGAAAGAGG - Intronic
941138290 2:161744748-161744770 CAAAAAGTTAAAAAGCAAGGAGG - Intronic
941247104 2:163112571-163112593 GGGTAATTTATAAAGGAAGGAGG + Intergenic
941484818 2:166067035-166067057 CTGAAGGTTAAAAAGGAGGAGGG - Intronic
941612401 2:167677753-167677775 CGGTAATTTATAAAGGAAAGAGG + Intergenic
942627214 2:177914510-177914532 CTGTGAGTTACAAAGGCAGATGG - Intronic
942682439 2:178491734-178491756 CTGTAATTTATAAAGAAAAGAGG + Intronic
942707280 2:178790178-178790200 ACGTAAGTCAAAAAGAAAGGAGG + Intronic
943033050 2:182708505-182708527 GGGTAATTTATAAAGGAAGGAGG + Intergenic
943136675 2:183922016-183922038 CTGTAATTTATAAAGGAAAGAGG - Intergenic
943220271 2:185094841-185094863 GTGTAATTTATAAAGGAAAGAGG - Intergenic
943391513 2:187275016-187275038 GGGTAATTTATAAAGGAAGGAGG - Intergenic
943823009 2:192351638-192351660 GGGTAATTTATAAAGGAAGGAGG + Intergenic
944045093 2:195401893-195401915 GGGTAATTTATAAAGGAAGGAGG - Intergenic
944335450 2:198528411-198528433 ATGAAAGTAAAAAATGAAGGGGG - Intronic
944991466 2:205241901-205241923 ATGTGAGTTATAAAGGAAGTTGG + Intronic
945562691 2:211358307-211358329 GTGTAATTTATAAAGGAAAGAGG + Intergenic
945587374 2:211683326-211683348 GGGTAAGTTTAAAGGGAAGGTGG - Intronic
946115434 2:217457762-217457784 GTGTAATTTATAAAGGAAGGAGG - Intronic
946201606 2:218073793-218073815 CTGAAAGTGAAAGAGGCAGGGGG - Intronic
946268178 2:218567223-218567245 CTGAAAGGTAAAATGGAAGGAGG - Intronic
946440209 2:219688596-219688618 GAGTAATTTATAAAGGAAGGAGG - Intergenic
946933930 2:224699975-224699997 ATGTAATTTATAAAGGAAAGAGG - Intergenic
946950568 2:224870296-224870318 CTGTAATTTATAAAGGAAGGAGG - Intronic
947101984 2:226630756-226630778 CGGTAATTTATAAAGGAAAGAGG - Intergenic
947189410 2:227486460-227486482 ATGTAAGTTAATAAGGCAGTAGG - Intronic
947313443 2:228829091-228829113 CTATAGGTGACAAAGGAAGGAGG - Intergenic
947453978 2:230236242-230236264 CTGTAACTGCAAAAGGAGGGTGG - Intronic
947757740 2:232580326-232580348 GTGTTAGATAAAAAGAAAGGGGG + Intronic
948878785 2:240844967-240844989 GGGTAATTTACAAAGGAAGGAGG - Intergenic
1168959495 20:1859128-1859150 CTCCTAGTTAAAAAGGAAGCTGG - Intergenic
1169043760 20:2519073-2519095 GGGTAATTTAAAAAGGAAAGAGG - Intronic
1169581869 20:7032680-7032702 CTGTAAGTTAAAAAATATAGGGG - Intergenic
1170000762 20:11610827-11610849 GAGGAAATTAAAAAGGAAGGTGG - Intergenic
1170065110 20:12302741-12302763 AGGTAATTTAAAAAGGAAAGAGG + Intergenic
1170293265 20:14794960-14794982 CTGAAGGCTGAAAAGGAAGGAGG + Intronic
1170581229 20:17701010-17701032 GTGTAAGGTAGAAAGGGAGGTGG + Intronic
1170924259 20:20708614-20708636 GGGTAATTTATAAAGGAAGGAGG - Intronic
1171095197 20:22326087-22326109 GTGTAAGTTTATAAGCAAGGTGG + Intergenic
1171297400 20:24030315-24030337 GGGTAAGTTATAAAGGAAAGAGG - Intergenic
1171724236 20:28601840-28601862 CTGCCAGTTAAAAAAGAAGCGGG + Intergenic
1171753820 20:29081197-29081219 CTGCCAGTTAAAAAAGAAGCGGG - Intergenic
1171788426 20:29496333-29496355 CTGCCAGTTAAAAAAGAAGCGGG + Intergenic
1171859128 20:30378180-30378202 CTGCCAGTTAAAAAAGAAGCGGG - Intronic
1172003380 20:31799597-31799619 CTGTCAATTAAAAAGAAAGAAGG + Intronic
1172045588 20:32077825-32077847 CTGTGGTATAAAAAGGAAGGAGG - Intronic
1172997104 20:39078992-39079014 GGGTAATTTACAAAGGAAGGAGG - Intergenic
1173197076 20:40924093-40924115 CTGTAATTTAAAAAAAAAGAGGG + Intergenic
1173887950 20:46478564-46478586 CAGTAATTTCAAAAGGGAGGAGG + Intergenic
1174762632 20:53221256-53221278 GGGTAATTTATAAAGGAAGGAGG - Intronic
1174882538 20:54296232-54296254 CAGTAACTTATAAAGGAAAGAGG + Intergenic
1174974313 20:55314501-55314523 CAATGAGTTAAGAAGGAAGGAGG - Intergenic
1175066298 20:56291460-56291482 GGGTAATTTATAAAGGAAGGAGG + Intergenic
1175370143 20:58482861-58482883 CTGTAAGTGCAGATGGAAGGAGG - Intronic
1175533954 20:59694424-59694446 CTGTAAGTATAAAATGAAAGAGG + Intronic
1176216269 20:63949418-63949440 CTGTCAGTCAAGAAGGAAGACGG + Intronic
1176659371 21:9619827-9619849 GGGTAATTTACAAAGGAAGGAGG + Intergenic
1176933231 21:14838909-14838931 CTGTAAGACCAGAAGGAAGGTGG + Intergenic
1177317606 21:19480638-19480660 GTGTAATTTAGAAAGGAAAGAGG + Intergenic
1177751854 21:25294399-25294421 CAGTAATTTATAAAGGAAAGAGG - Intergenic
1177770031 21:25503933-25503955 GGGTAATTTATAAAGGAAGGAGG - Intergenic
1178556745 21:33597913-33597935 TTGTACATTAAAAAGTAAGGAGG - Intronic
1178773513 21:35527663-35527685 CTGTAAGTCAAAAATCAAGGTGG + Intronic
1178798343 21:35766775-35766797 GGGTAATTTATAAAGGAAGGAGG + Intronic
1179066850 21:38032753-38032775 CTGGAAATGAGAAAGGAAGGTGG - Intronic
1179128839 21:38616249-38616271 GTGTAATTTATAAAGGAAAGAGG - Intronic
1179310610 21:40192558-40192580 GGGTAATTTATAAAGGAAGGAGG - Intronic
1180135397 21:45859018-45859040 GTGTAATTTATAAAGGAAAGAGG - Intronic
1180297785 22:10960515-10960537 CTGCCAGTTAAAAAAGAAGCGGG + Intergenic
1180410635 22:12603274-12603296 CTGCCAGTTAAAAAAGAAGCAGG - Intergenic
1181163737 22:20972746-20972768 CTGTAATTGAAAAAGGAGGCGGG + Intronic
1181746648 22:24959697-24959719 CTGTACGAGAAGAAGGAAGGGGG + Intronic
1182400955 22:30077451-30077473 CTGAAAGGTACAAAGGAAGCTGG + Intergenic
1182608418 22:31526230-31526252 AAGTAATTTATAAAGGAAGGAGG + Intronic
1182799907 22:33023473-33023495 GTGTAATTTATAAAGGAAAGGGG - Intronic
1182925406 22:34118599-34118621 TTGTCAATTAAAAAGGATGGAGG - Intergenic
1183813995 22:40283590-40283612 CTGTAACTTAATATGGAAGCTGG - Intronic
1184592542 22:45494688-45494710 CTGTAATTTATAAAGGAAAGAGG + Intergenic
1184844325 22:47071934-47071956 CTGCAATATAAAAAGGCAGGGGG - Intronic
949424335 3:3900176-3900198 GGGTAATTTATAAAGGAAGGAGG - Intronic
949687753 3:6597158-6597180 CAGTAATTTATAAAGGAAAGAGG + Intergenic
949868006 3:8562592-8562614 CTGTGAGATAAATAGGAATGTGG + Intronic
950355910 3:12408964-12408986 CTTTGAGTTAAAAAATAAGGAGG + Intronic
951150077 3:19278380-19278402 TTGAAAGGAAAAAAGGAAGGAGG + Intronic
951858690 3:27226380-27226402 CTGAAAGAGAAAGAGGAAGGTGG + Intronic
952264489 3:31772295-31772317 CTAAATGTTAAAAAGGAAAGGGG - Intronic
952307850 3:32161219-32161241 CTGAAAGTTAAAAATGAGGGTGG + Intronic
954203151 3:49037402-49037424 CTGTAAGACAAAAGGGAGGGGGG + Intronic
955038199 3:55289463-55289485 GGGTAATTTATAAAGGAAGGAGG - Intergenic
956052978 3:65268432-65268454 GGGTAATTTAAAAAGGAAAGAGG - Intergenic
956228801 3:66989448-66989470 CTGTAAGTGACCAAGGAAAGGGG - Intergenic
956984018 3:74675656-74675678 TTGAAGGTTAAAAAGCAAGGAGG - Intergenic
957377447 3:79376709-79376731 GTGTAACTTATAAAGGAAAGAGG - Intronic
957425555 3:80034825-80034847 GGGTAATTTATAAAGGAAGGAGG + Intergenic
957611037 3:82466809-82466831 GAGTAATTTATAAAGGAAGGAGG - Intergenic
957660341 3:83143356-83143378 CTGGAAGATCAAAAGCAAGGTGG - Intergenic
957787775 3:84904194-84904216 CTGGAGGTTAAAAAGGGAAGAGG - Intergenic
957987598 3:87591221-87591243 CAGTAATTTATAAAGGAAAGAGG + Intergenic
958469923 3:94503998-94504020 GAGTAATTTAAAAAGGAAAGAGG + Intergenic
958505291 3:94968963-94968985 ATGGGAGATAAAAAGGAAGGGGG - Intergenic
959190554 3:103105081-103105103 CAGTAAGCTAAAAAGCAAGAAGG - Intergenic
959203216 3:103274367-103274389 CTGTAAGTTTTAAAGTCAGGTGG + Intergenic
959281183 3:104343082-104343104 CTGAAGGTCAAAAAGGAAAGAGG + Intergenic
959395236 3:105829009-105829031 CTGTAACTTAAAAAGAATTGTGG - Intronic
959401196 3:105904146-105904168 CGGTAATTTATAAAGGAAAGAGG - Intergenic
959525176 3:107368553-107368575 GTGTAATTTAAAAAGAAAAGAGG + Intergenic
959601170 3:108187579-108187601 ATGTAAGTTAAAAAAAAAAGGGG + Intronic
959849150 3:111067869-111067891 GTGTAATTTATAAAGGAAAGAGG - Intergenic
960272433 3:115689660-115689682 CAGAATGTGAAAAAGGAAGGTGG + Intronic
960328484 3:116326811-116326833 GTGTAAGGGTAAAAGGAAGGTGG - Intronic
960331888 3:116369947-116369969 TTGGAAGTTTAAAATGAAGGCGG - Intronic
960404746 3:117245967-117245989 GGGTAATTTATAAAGGAAGGAGG - Intergenic
960739760 3:120820202-120820224 CTATCAGATAAAAAGTAAGGTGG - Intergenic
961024600 3:123543113-123543135 CTGTAATTTAAAACGGAATGAGG - Intronic
961690427 3:128665606-128665628 CTTTAAGTGGTAAAGGAAGGGGG - Intronic
961797882 3:129422805-129422827 CTGTGAGACAAAAAGGAATGGGG - Intronic
962107273 3:132404012-132404034 GGGTAATTTAAAAAGGAAAGTGG - Intergenic
962342582 3:134597776-134597798 GTGGAAGTTAAAAGGGAGGGGGG - Intergenic
962525481 3:136234134-136234156 CTGTAAGATAAAATGGGGGGAGG - Intergenic
962607559 3:137045128-137045150 ATGTAGGATAAAGAGGAAGGAGG + Intergenic
962650479 3:137483718-137483740 GGGTAATTTATAAAGGAAGGAGG - Intergenic
962723940 3:138203556-138203578 CTGTTAGAGAAAAAGGGAGGGGG + Intronic
963730875 3:148970817-148970839 CTGTCAGTTAAAAAATAAGGGGG - Intergenic
963997351 3:151725252-151725274 GGGTAATTTAAAAAGGAAAGAGG + Intergenic
964128613 3:153263132-153263154 CTGTAATTTCAAGAGGAAAGAGG - Intergenic
964333842 3:155633960-155633982 CTTTAAGTTAAAAAAAAAGATGG - Intronic
964335180 3:155647083-155647105 TTGGAAATCAAAAAGGAAGGTGG - Intronic
964929607 3:162001109-162001131 GGGTAATTTAAAAAGGAAAGAGG - Intergenic
965839244 3:172884071-172884093 AGGTAATTTATAAAGGAAGGAGG - Intergenic
966010707 3:175072544-175072566 CTGCAACTTAAAATGGAGGGTGG + Intronic
966126850 3:176587942-176587964 ATGTAAATTAAAAAGAAAGTTGG + Intergenic
966128290 3:176606208-176606230 CTGTATGTTAGAACAGAAGGTGG - Intergenic
966274636 3:178150649-178150671 ATTTAAGCTAAAAAGGTAGGTGG - Intergenic
966496738 3:180590070-180590092 ATTTAGGTTAAAAAGAAAGGGGG + Intergenic
966992653 3:185249712-185249734 GGGTAATTTATAAAGGAAGGAGG - Intronic
967551738 3:190803210-190803232 CTGTAATTTCCAAAGGAGGGAGG - Intergenic
967640929 3:191862147-191862169 GGGTAATTTATAAAGGAAGGAGG + Intergenic
967674478 3:192279708-192279730 ACAAAAGTTAAAAAGGAAGGAGG + Intronic
968530685 4:1089906-1089928 CGGTAATTTATAAAGGAAAGAGG - Intronic
968543439 4:1180792-1180814 GTGTAAGTAAAAAAGGAAATAGG + Intronic
968622428 4:1609976-1609998 GTGTAATTTATAAAGGAAAGAGG - Intergenic
968738090 4:2309347-2309369 CAGTAATTTATAAAGCAAGGAGG - Intronic
969108333 4:4825238-4825260 GGGTAATTTATAAAGGAAGGAGG + Intergenic
969198977 4:5586522-5586544 CTGAAATTCCAAAAGGAAGGAGG - Intronic
969947522 4:10799693-10799715 GGGTAATTTAAAAAGGAAAGTGG + Intergenic
970039146 4:11776359-11776381 GGGTAATTTATAAAGGAAGGAGG - Intergenic
970100519 4:12515807-12515829 GTGTAATTTATAAAGGAAAGAGG - Intergenic
971278069 4:25216770-25216792 GTGTAATTTATAAAGAAAGGAGG + Intronic
971394054 4:26212545-26212567 CAGTATGTGAAAAAAGAAGGTGG - Intronic
971591484 4:28474297-28474319 GGGTAATTTAAAAAGGAAAGTGG - Intergenic
971671206 4:29560534-29560556 CTGTAATTTATAAAGAAAAGAGG + Intergenic
972137445 4:35909165-35909187 CTGTAAGATCAAAAGCAAGTTGG - Intergenic
972242679 4:37210284-37210306 GGGTAATTTATAAAGGAAGGAGG - Intergenic
972325247 4:38009127-38009149 TCGTAAGGTATAAAGGAAGGGGG - Intronic
972363031 4:38346353-38346375 GGGTAATTTATAAAGGAAGGAGG - Intergenic
972660339 4:41110090-41110112 CTGTAAATTAGAAAGAAAGGTGG - Intronic
973130603 4:46643596-46643618 CAGTAAGTTAAAAAGGCTGTAGG - Intergenic
973597806 4:52510617-52510639 CTGTTTTTTAAATAGGAAGGGGG + Intergenic
974059885 4:57022555-57022577 CCATAATTTAGAAAGGAAGGGGG - Intronic
974178560 4:58357322-58357344 GGGTAATTTAAAAAGGAAAGAGG - Intergenic
974319813 4:60333132-60333154 GGGTAATTTATAAAGGAAGGAGG - Intergenic
975388030 4:73781471-73781493 GTGTAATTTATAAAGGAAAGAGG + Intergenic
975903321 4:79179816-79179838 GAGTAATTTATAAAGGAAGGAGG + Intergenic
975967958 4:79998646-79998668 CCCTAGGTTAAAAAGGCAGGAGG - Intronic
976706586 4:88025971-88025993 CGGTAATTTATAAAGGAAAGAGG - Intronic
976820540 4:89201650-89201672 GGGTAATTTATAAAGGAAGGAGG + Intergenic
977021330 4:91764431-91764453 GGGTAATTTATAAAGGAAGGAGG - Intergenic
977104197 4:92859522-92859544 CTATAAGATAACAAGGAAGAAGG - Intronic
977176425 4:93825985-93826007 GAGTAATTTATAAAGGAAGGAGG - Intergenic
977641075 4:99359134-99359156 GTGTAATTTATAAAGGAAAGAGG - Intergenic
977880236 4:102196351-102196373 CTAAAAGTGGAAAAGGAAGGTGG + Intergenic
977917806 4:102613402-102613424 CTGTGAGAAAGAAAGGAAGGAGG - Intronic
977953358 4:102999868-102999890 GAGTAATTTAAAAAGGAAAGAGG + Intronic
978068101 4:104431401-104431423 GGGTAATTTAAAAAGGAAAGAGG + Intergenic
978330425 4:107607180-107607202 CTGAAAGTCAAAAACCAAGGAGG + Intronic
978623944 4:110663415-110663437 CTGTTATTGAAAAAGCAAGGGGG + Intergenic
978831524 4:113091272-113091294 CTGAAAGCTACAAAGAAAGGAGG + Intronic
978943309 4:114463972-114463994 CTGTAAGTTTTAAAGGATGAAGG - Intergenic
979368864 4:119858817-119858839 GGGTAAGTTATAAAGGAAAGAGG - Intergenic
979420439 4:120498447-120498469 GGGTAATTTATAAAGGAAGGGGG - Intergenic
979453890 4:120904214-120904236 GAGTAATTTATAAAGGAAGGAGG - Intronic
979561000 4:122102198-122102220 CTGTAATTCAACAAGGCAGGTGG + Intergenic
979613292 4:122712333-122712355 CTGCAAGTAATAAAGTAAGGAGG - Intergenic
979909206 4:126339664-126339686 GTGTAATTTATAAAGGAAAGAGG + Intergenic
980086101 4:128391647-128391669 CAGACAGTTAACAAGGAAGGTGG - Intergenic
980479135 4:133362818-133362840 AGGTAATTTAAAAAGGAAAGAGG - Intergenic
981363153 4:143870863-143870885 GTGTAATTTATAAAGGAAAGAGG + Exonic
981373884 4:143991657-143991679 GTGTAATTTATAAAGGAAAGAGG + Intergenic
982160976 4:152569133-152569155 CTCTTGGTTAAAAAAGAAGGGGG + Intergenic
983013449 4:162579323-162579345 GTGTAATTTATAAAGGAAAGAGG - Intergenic
983955389 4:173692027-173692049 CAGTAATTTATAAAGGAAAGAGG + Intergenic
983967403 4:173829675-173829697 GTGTAATTTACAAAGGAAAGAGG - Intergenic
984132203 4:175891691-175891713 CTGTAAGAGAGAAAAGAAGGTGG + Intronic
984450327 4:179892630-179892652 GTGTAAATTATAAAGGAAAGAGG + Intergenic
984624072 4:181986259-181986281 CTTCAAGAGAAAAAGGAAGGAGG - Intergenic
984716877 4:182934085-182934107 GTGTAAGTTAAAGTGGATGGAGG - Intergenic
985362642 4:189192155-189192177 CAGTAAGTAAAATAGGAAGAAGG + Intergenic
985381503 4:189399520-189399542 GGGTAATTTAAAAAGGAAAGGGG - Intergenic
985416132 4:189737370-189737392 GGGTAATTTACAAAGGAAGGAGG - Intergenic
985437250 4:189941810-189941832 CTGCCAGTTAAAAAAGAAGCGGG - Intronic
985771308 5:1813409-1813431 CTGTGAGGTGGAAAGGAAGGAGG - Intronic
986277441 5:6290143-6290165 GGGTAATTTATAAAGGAAGGAGG + Intergenic
986449050 5:7848925-7848947 CGGTAATTTATAAAGGAAAGAGG - Intronic
986469918 5:8063407-8063429 CTTTAAGTGAGAAAGGATGGAGG - Intergenic
986906782 5:12503958-12503980 CGGTAAGTTATAAAGGAAATAGG - Intergenic
986933038 5:12851271-12851293 GGGTAATTTACAAAGGAAGGAGG - Intergenic
987153721 5:15066885-15066907 GGGTAATTTATAAAGGAAGGAGG + Intergenic
987208996 5:15659079-15659101 GTGTAATTTATAAAGGAAAGAGG - Intronic
987388812 5:17355898-17355920 CGGTAATTTATAAAGGAAAGAGG - Intergenic
987668732 5:20981095-20981117 GTGTAATTTATAAAGGAAAGAGG + Intergenic
987705128 5:21453371-21453393 CTGGAAGTTCAAAATTAAGGTGG + Intergenic
987797704 5:22651337-22651359 GGGCAATTTAAAAAGGAAGGGGG + Intronic
987897368 5:23964987-23965009 GGGTAATTTAAAAAGGAAAGAGG + Intronic
988090927 5:26540765-26540787 CTGTGAGTTTAAAAGGAATAAGG + Intergenic
988300798 5:29423824-29423846 CTGGAAGTTCAAAATTAAGGTGG - Intergenic
988307246 5:29508012-29508034 GGGTAATTTATAAAGGAAGGAGG - Intergenic
988470599 5:31533461-31533483 CTGGACGTTAAAAAAGAAGAGGG + Intronic
989460365 5:41690668-41690690 GGGTAAGTTATAAAGGAAAGGGG - Intergenic
989540012 5:42607213-42607235 GGGTAACTTAAAAAGGAAAGAGG - Intronic
989739437 5:44753046-44753068 GGGTAATTTAAAAAGGAAAGAGG - Intergenic
989805791 5:45602151-45602173 GGGTAAGTTATAAAGGAAGGTGG - Intronic
990049606 5:51481330-51481352 CCATAAATTAAAAAGGAAAGTGG - Intergenic
990352746 5:54935105-54935127 CTGGAAGTAATAAAGGAAGAAGG - Intergenic
990454434 5:55971376-55971398 ATGTAAGATAAACTGGAAGGAGG - Intronic
991041297 5:62178413-62178435 ATTTAAGTTAAAAAAGAAGGAGG + Intergenic
991041387 5:62179155-62179177 CTGTAAGGTAAAAAAGAATTGGG - Intergenic
991226869 5:64283781-64283803 GTGTAATTTATAAAGGAAAGAGG - Intronic
991696720 5:69279853-69279875 CAGTAATTTATAAAGGAAAGAGG + Intergenic
992357763 5:76003221-76003243 GGGTAAGTTATAAAGGAAAGAGG - Intergenic
992903534 5:81322677-81322699 CAGTAATTTATAAAGGAAAGAGG + Intergenic
993041729 5:82822314-82822336 CTGTGAGTTAGAAAGGGAAGAGG + Intergenic
993090258 5:83416852-83416874 GGGTAATTTAAAAAGGAAAGAGG - Intergenic
993167424 5:84374931-84374953 GGGTAATTTATAAAGGAAGGAGG - Intronic
993282309 5:85940379-85940401 CTGCAATTGAAAATGGAAGGTGG - Intergenic
993331323 5:86604224-86604246 GTGTAATTTATAAAGGAAAGAGG + Intergenic
993608819 5:90029581-90029603 TTGAAACTTAAAAAGGAAGGTGG - Intergenic
994293919 5:98065812-98065834 CTGCAATTTAAAGAGCAAGGAGG - Intergenic
994413439 5:99438656-99438678 GTAAAAGTGAAAAAGGAAGGTGG - Intergenic
994657691 5:102614063-102614085 CAGTAATTTACAAAGGAAAGAGG - Intergenic
994979616 5:106856876-106856898 TGGAAAGTTAAAAAGGAAAGAGG + Intergenic
995353920 5:111215211-111215233 GGGTAATTTATAAAGGAAGGAGG - Intergenic
995358908 5:111270870-111270892 GAGTAATTTATAAAGGAAGGAGG + Intronic
995559511 5:113365149-113365171 CTGGAATTTAAAAAGGAAGGAGG - Intronic
995650895 5:114366703-114366725 CAATAAGTAAAAAAGGAGGGCGG - Intronic
995841922 5:116450405-116450427 CTCTCAGTTTAAAAGGAACGTGG + Intronic
996119384 5:119653521-119653543 TGGTAATTTATAAAGGAAGGAGG - Intergenic
996274020 5:121642597-121642619 GGGTAATTTAAAAAGGAAAGAGG + Intergenic
996467901 5:123824923-123824945 CGGTAATTTATAAAGGAAAGAGG - Intergenic
996945519 5:129062491-129062513 CTGTATATTAACAAGGCAGGAGG - Intergenic
997374287 5:133385692-133385714 CTGTAATTAAAAAAGGAAGGAGG - Intronic
998802723 5:145886586-145886608 TGGTAAGTTAGAAATGAAGGAGG - Intergenic
999063508 5:148660198-148660220 CTGTAACTAAAAAATGAATGTGG + Intronic
999578655 5:153009656-153009678 GTGTAATTTATAAAGGAAAGAGG + Intergenic
1001501885 5:172243460-172243482 CTGTATGTAAAACAGGAAGATGG + Intronic
1002353071 5:178598449-178598471 TCGTAATTTATAAAGGAAGGAGG - Intergenic
1002588106 5:180265626-180265648 GTGTAACTTATAAAGGAAAGCGG - Intronic
1003134450 6:3423566-3423588 CTGTAAGTTAAAAAGGAAGGAGG + Intronic
1003701735 6:8473714-8473736 GGGTAACTTAAAAAGGAAAGAGG + Intergenic
1004343718 6:14829507-14829529 CTTTAAGCTAAGAAGGAAAGAGG + Intergenic
1004697550 6:18047881-18047903 CAATAAGTTATCAAGGAAGGTGG - Intergenic
1004789918 6:19013657-19013679 CTGGAAGTCAAAAAGGAGGAGGG + Intergenic
1004830642 6:19473800-19473822 GGGTAATTTATAAAGGAAGGAGG - Intergenic
1004894257 6:20131554-20131576 CGGTAATTTATAAAGGAAAGAGG - Intronic
1005069432 6:21850949-21850971 GTGTTAGTTAAAGAGGAAGTGGG - Intergenic
1006590742 6:35154286-35154308 CTATCAGTCAAAAAGGCAGGAGG - Intergenic
1006703854 6:35999885-35999907 CTTTAAGATAGAAAGAAAGGAGG - Intronic
1006990961 6:38214377-38214399 CTGTGAGTTCACAAAGAAGGTGG + Intronic
1008295281 6:49768255-49768277 CTATAAGTTACAAAAGAGGGAGG + Intergenic
1008326489 6:50187976-50187998 CTGGGAGTTTAAAAGGAGGGGGG + Intergenic
1008711026 6:54227248-54227270 CAGTAATTTATAAAGGAAAGAGG - Intronic
1008830981 6:55761536-55761558 CTGTGAGTGAAACAGCAAGGAGG - Intronic
1009722700 6:67494558-67494580 CTGTAACTTAAAAAAGAGTGAGG - Intergenic
1009884991 6:69615553-69615575 AAGTAAGTTAAAAAGGAAGAAGG + Intergenic
1011382883 6:86761091-86761113 GGGTAATTTAAAAAGGAAGTAGG - Intergenic
1011558587 6:88592907-88592929 CAGTAATTTATAAAGGAAAGAGG - Intergenic
1011738114 6:90332904-90332926 GAGTAAATTATAAAGGAAGGAGG + Intergenic
1011829417 6:91353164-91353186 GTGGAAGTTAAACAGGAAGCAGG - Intergenic
1011830984 6:91371094-91371116 CTGTAATTTATAAAGGAAAGAGG - Intergenic
1011993980 6:93561453-93561475 CTGTAATTTATAAAGAAAAGAGG - Intergenic
1012126118 6:95429512-95429534 GTGTAATTTATAAAGGAAGGAGG - Intergenic
1012515629 6:100055597-100055619 GTGTAATTTATAAAGAAAGGAGG - Intergenic
1012857002 6:104513845-104513867 GTGTAATTTATAAAGGAAAGAGG - Intergenic
1012961340 6:105625313-105625335 CTGAAAGAGAAAAGGGAAGGGGG + Intergenic
1014429683 6:121353561-121353583 GGGTAATTTAAAAAGGAAAGAGG + Intergenic
1014463241 6:121724394-121724416 CTGTAATATAAAAAGGATGTGGG + Intergenic
1014614001 6:123579994-123580016 GTGTAATTTATAAAGGAAAGAGG - Intronic
1014817971 6:125955867-125955889 CTGTATGTCAAAAAGGTTGGTGG + Intergenic
1014876614 6:126668732-126668754 GTGTAATTTATAAAGGAAAGAGG - Intergenic
1015288704 6:131512741-131512763 CAGTAATTTCAAAAGGGAGGAGG - Intergenic
1015351711 6:132226654-132226676 CGGTAATTTATAAAGGAAAGTGG - Intergenic
1016158667 6:140847404-140847426 TTGTAAGAAAAAAAGGAAGTTGG + Intergenic
1016512852 6:144863054-144863076 GTGTAATTTATAAAGGAAAGAGG - Intergenic
1016629636 6:146213386-146213408 CTGGAAGTGAAAAAGCAAGAAGG + Intronic
1016732308 6:147439920-147439942 GGGTAATTTATAAAGGAAGGAGG + Intergenic
1017052359 6:150405471-150405493 GAGTAATTTATAAAGGAAGGAGG + Intronic
1017268087 6:152474676-152474698 GTGTAAGATAAAAAGGACAGTGG + Intronic
1017349523 6:153423254-153423276 CTGTCAGTAAGAAAGGAAGATGG - Intergenic
1017395798 6:153998530-153998552 AAATAAGTTAAAAAGTAAGGTGG - Intergenic
1017428457 6:154346570-154346592 CGGTAATTTATAAAGGAAAGAGG + Intronic
1018070740 6:160162206-160162228 TTGCAAATTAAACAGGAAGGAGG + Intergenic
1018164062 6:161077416-161077438 TTATAAGTTAAAAAGCAAAGAGG - Intronic
1018184844 6:161257702-161257724 ATGGAAATTAAAAAGGAATGTGG + Intronic
1018489592 6:164278652-164278674 CTGTAATTTATAAAGGAAAGGGG - Intergenic
1018489863 6:164280579-164280601 GTGTAATTTATAAAGGAAAGAGG - Intergenic
1019937511 7:4266073-4266095 CTGTCAGGTGAGAAGGAAGGGGG - Exonic
1020799619 7:12717857-12717879 CTGTTTGTAAAACAGGAAGGGGG + Intergenic
1021138672 7:16996354-16996376 GGGTAATTTAAAAAGGAAAGAGG + Intergenic
1021230334 7:18079911-18079933 GGGTAATTTAAAAAGGAAAGAGG + Intergenic
1021292128 7:18858867-18858889 CTGTGAGTTAGAAGGGAAGTAGG - Intronic
1021787040 7:24162891-24162913 GGGTAATTTACAAAGGAAGGAGG - Intergenic
1022359424 7:29644150-29644172 CTGTAAGTCAAGAAGAGAGGGGG - Intergenic
1022715371 7:32892936-32892958 CTGTAAGTTAGGAAGGTAGGTGG - Intronic
1022819858 7:33948868-33948890 CTGTGAGATAAGCAGGAAGGAGG + Intronic
1022851082 7:34262853-34262875 GTGTAATTTATAAAGGAAAGTGG - Intergenic
1023793601 7:43772592-43772614 GGGTAATTTAAAAAGGAAAGAGG + Intronic
1024445498 7:49473598-49473620 GGGTAATTTACAAAGGAAGGAGG + Intergenic
1024912314 7:54459202-54459224 GTGTAATTTATAAAGAAAGGAGG - Intergenic
1025721691 7:64021380-64021402 AGGTAAATTAAAAAGGAAAGAGG - Intergenic
1026058618 7:67006778-67006800 CTGTAATTTATAAAGAAAAGAGG + Intronic
1026272778 7:68851056-68851078 CTTTAAGTTAATCAGAAAGGAGG - Intergenic
1026323952 7:69292875-69292897 GAGTAATTTATAAAGGAAGGAGG + Intergenic
1026573702 7:71554433-71554455 GGGTAAGTTATAAAGGAAAGAGG - Intronic
1026675746 7:72426552-72426574 GTGTAATTTATAAAGGAAAGAGG - Intronic
1027279318 7:76594294-76594316 GGGTAAATTATAAAGGAAGGAGG + Intergenic
1027759341 7:82258243-82258265 CTGTAATTTATAAAGGAAATGGG - Intronic
1028957666 7:96712263-96712285 AGGTAATTTATAAAGGAAGGAGG - Intergenic
1028994980 7:97090229-97090251 CTGTAATTTAACAAGTCAGGAGG + Intergenic
1029033905 7:97498271-97498293 GGGTAATTTAAAAAGGAAAGAGG - Intergenic
1029569857 7:101362389-101362411 CTGGAGGTTAAAGGGGAAGGAGG + Intergenic
1029910423 7:104140479-104140501 CTGTAAGTTGGAAATAAAGGAGG - Intronic
1029965873 7:104740216-104740238 GTGTAATTTATAAAGGAAAGAGG - Intronic
1030068992 7:105682309-105682331 CTGTACGTTAAAAATTAAGATGG + Intronic
1030285217 7:107819292-107819314 ATGTCAGTTAAAAATGAAGCTGG + Intergenic
1030448829 7:109682906-109682928 TTATAAGTTAAAAAGGAAATTGG + Intergenic
1030450111 7:109698613-109698635 GGGTAATTTATAAAGGAAGGAGG + Intergenic
1030495388 7:110292287-110292309 ATTTAAGTTAAATAGGAAGTAGG - Intergenic
1030907522 7:115205618-115205640 GGGTAATTTATAAAGGAAGGAGG + Intergenic
1031243222 7:119271715-119271737 CTTTAAGTCAAAAAGGAAAATGG - Intergenic
1031310893 7:120195667-120195689 GTGGAAGTCAAAGAGGAAGGAGG - Intergenic
1031562026 7:123250348-123250370 GTGTAAATTATAAAGGAAAGAGG + Intergenic
1031913963 7:127545283-127545305 CAGTAATTTATAAAGGAAAGAGG + Intergenic
1032317559 7:130853813-130853835 CTGTCCATTAAACAGGAAGGAGG + Intergenic
1032801016 7:135317386-135317408 CGGTAAATTACAAAGGAGGGGGG - Intergenic
1032811514 7:135423619-135423641 CAGTAAGTTAAAATTGAAAGTGG - Intronic
1032958676 7:137004019-137004041 GTGTAACTTATAAAGGAATGAGG - Intronic
1033017560 7:137687278-137687300 CTTTCAAATAAAAAGGAAGGTGG - Intronic
1033080807 7:138295344-138295366 GGGTAATTTAAAAAGGAAAGAGG - Intergenic
1033241844 7:139686705-139686727 GGGTAATTTAAAAAGGAAAGAGG - Intronic
1033775493 7:144605515-144605537 ATGTAAGTTAAAGAAGAAGATGG - Intronic
1033820312 7:145126756-145126778 CAGTAATTTATAAAGGAAAGAGG - Intergenic
1034778135 7:153850591-153850613 GTGTAATTTATAAAGGAAAGAGG + Intergenic
1035227956 7:157443957-157443979 GTGTAAGTTAAAACTGAAGAAGG - Intergenic
1035787612 8:2274444-2274466 CGGTAATTTATAAAGGAAGATGG - Intergenic
1035805198 8:2447272-2447294 CGGTAATTTATAAAGGAAGATGG + Intergenic
1036045151 8:5131708-5131730 CTGTAAGTTTCAAAGGATGTTGG + Intergenic
1036059314 8:5297476-5297498 CTTCAAGTTAAAAGGGAAGCAGG + Intergenic
1036121395 8:6021282-6021304 CAGTAATTTATAAAGGAAAGAGG + Intergenic
1036552893 8:9830738-9830760 CTGAAAGTTAAAAAGAAAGATGG - Intergenic
1036799712 8:11781266-11781288 CTGGAAGTTCAGAAGGAGGGTGG + Intronic
1036934536 8:12988461-12988483 GTGTAATTTATAAAGGAAAGAGG + Intronic
1037365711 8:18119970-18119992 GAGTAATTTAAAAAGAAAGGAGG - Intergenic
1037440025 8:18905700-18905722 ATGTAAGATAAAAAGTAAGTAGG - Intronic
1037477897 8:19275694-19275716 GGGTAATTTAAAAAGGAAAGAGG + Intergenic
1037626300 8:20610192-20610214 GGGTAATTTAAAAAGGAAAGAGG + Intergenic
1037790130 8:21931453-21931475 CTGTAAGTTAATAAGAAATAAGG - Intronic
1038214012 8:25545203-25545225 GGGTAATTTATAAAGGAAGGAGG + Intergenic
1038309255 8:26433407-26433429 GTGTAATTTATAAAGGAAAGAGG + Intronic
1038430230 8:27494061-27494083 CTGTTTGTTAAACAGGGAGGAGG + Intronic
1040504438 8:48034571-48034593 GTATAAGTTAAAAAAAAAGGGGG - Intronic
1041213054 8:55572065-55572087 CTGTGAGCAAACAAGGAAGGGGG - Intergenic
1041215158 8:55593176-55593198 ATGTGAGCTAAAATGGAAGGAGG - Intergenic
1041369832 8:57147633-57147655 CTGTAACTTAAAAAGTAAGGTGG + Intergenic
1041659195 8:60384540-60384562 CTGGAAGTTATAAGGTAAGGTGG - Intergenic
1041732402 8:61075853-61075875 ATGTAAGGGAAGAAGGAAGGAGG - Intronic
1041976953 8:63810480-63810502 CTGTAATTTATAAAGGAAAGAGG + Intergenic
1041977725 8:63818523-63818545 GGGTAATTTAAAAAGGAAGAAGG + Intergenic
1042164761 8:65934720-65934742 GTGTAATTTATAAAGGAAAGAGG - Intergenic
1042650426 8:71034424-71034446 GGGTAATTTAAAAAGGAAAGAGG - Intergenic
1042827335 8:72992199-72992221 GGGTAATTTATAAAGGAAGGAGG - Intergenic
1043034209 8:75177067-75177089 CTTTAATTTACAAAGGAAAGTGG + Intergenic
1043073445 8:75666128-75666150 CAGTAATTTATAAAGGAAAGAGG - Intergenic
1043074013 8:75673235-75673257 GGGTAATTTATAAAGGAAGGAGG - Intergenic
1043213263 8:77551639-77551661 CTTTAATTTAAAAAAGAAAGTGG - Intergenic
1043266138 8:78269886-78269908 GTGTAATTTATAAAGGAAAGAGG + Intergenic
1043725104 8:83601713-83601735 CTCTAAATTAAAAAAGAAGATGG + Intergenic
1043841814 8:85114626-85114648 GTGTAATTTAAAAGGGAAGAAGG + Intronic
1044193774 8:89351122-89351144 TTGTAAGTTAAAAAAAAATGTGG + Intergenic
1044207090 8:89503184-89503206 GGGTAATTTATAAAGGAAGGAGG - Intergenic
1044225798 8:89716717-89716739 GGGTAATTTAAAAAGGAAAGAGG - Intergenic
1044324487 8:90844303-90844325 CTGGAGGTTAAGAAGAAAGGAGG - Intronic
1045147770 8:99366905-99366927 CAAAAAGTTAAAAAGCAAGGGGG - Intronic
1045613602 8:103878253-103878275 GGGTAATTTAAAAAGGAAAGAGG - Intronic
1045891082 8:107158421-107158443 CTGGAAGCTCAAAAGCAAGGGGG - Intergenic
1045942790 8:107757559-107757581 CCGTAATTTATAAAGGAAAGAGG - Intergenic
1046038871 8:108878133-108878155 CTGTATGTCAAAAAGCAAAGGGG - Intergenic
1046065807 8:109195603-109195625 GGCTAATTTAAAAAGGAAGGAGG + Intergenic
1046430135 8:114113707-114113729 GGGTAATTTATAAAGGAAGGAGG - Intergenic
1046502471 8:115096410-115096432 CTGTAGGATAAACAGGAAGATGG + Intergenic
1046813753 8:118561451-118561473 GAGTAATTTAAAAAGGAAAGAGG + Intronic
1046917546 8:119693083-119693105 GGGTAATTTATAAAGGAAGGAGG - Intergenic
1046968658 8:120195548-120195570 GGGTAATTTAAAAAGGAAAGCGG + Intronic
1047010950 8:120672026-120672048 CTGAAAGTGAAAAAGCAGGGAGG - Intronic
1047669471 8:127128995-127129017 CAGCAAGCTAAAGAGGAAGGGGG - Intergenic
1047865256 8:129016574-129016596 GGGTAATTTAAAAAGGAAAGAGG - Intergenic
1048614412 8:136058484-136058506 GTGTAATTTATAAAGGAAAGAGG - Intergenic
1048777425 8:137962564-137962586 GTGTAATTTATAAAGGAAAGAGG - Intergenic
1049820595 8:144630911-144630933 CTGTAATTTATAAAGAAAAGAGG + Intergenic
1050412442 9:5381107-5381129 AGGTAATTTAAAAAGGAAAGAGG - Intronic
1050449401 9:5763846-5763868 CTGTAAGATAATAAGGTAAGAGG - Exonic
1050511063 9:6396342-6396364 TTGTAATCTTAAAAGGAAGGTGG + Intergenic
1050585918 9:7111525-7111547 CTGTAAGTTATACAGGTAGTAGG + Intergenic
1050660184 9:7875958-7875980 ATGTAATTTATAAAGGAAAGAGG - Intronic
1051183469 9:14435774-14435796 CTCTGTGTTTAAAAGGAAGGTGG + Intergenic
1051786219 9:20746779-20746801 CTATACATTAAAAAGTAAGGCGG - Intronic
1051984107 9:23062681-23062703 GGGTAATTTATAAAGGAAGGAGG + Intergenic
1052354680 9:27492203-27492225 CTGTGGGGTAAAAATGAAGGGGG + Intronic
1053145951 9:35712220-35712242 CTGAAAGTGAAAAAAGAAAGGGG + Intronic
1053318651 9:37075634-37075656 CTGGAAAATAAAAAGGAAGGAGG + Intergenic
1053467500 9:38320016-38320038 CTGGTAGTTAAAAAACAAGGTGG + Intergenic
1053725363 9:40993230-40993252 CTGCCAGTTAAAAAAGAAGCGGG - Intergenic
1054340578 9:63858650-63858672 CTGCCAGTTAAAAAAGAAGCAGG + Intergenic
1055178076 9:73345677-73345699 CATTAAGTAAAAAAGGAAGGTGG - Intergenic
1055195992 9:73594767-73594789 GTGGAGTTTAAAAAGGAAGGTGG + Intergenic
1055367140 9:75556658-75556680 AGGTAATTTAAAAAGGAAAGAGG - Intergenic
1056119682 9:83475072-83475094 CTGTAAATAAAAAATGATGGAGG - Intronic
1056434959 9:86566751-86566773 GGGTAATTTATAAAGGAAGGAGG + Intergenic
1056726048 9:89118644-89118666 AGGTTACTTAAAAAGGAAGGAGG + Intronic
1057233183 9:93337618-93337640 GTGTAATTTATAAAGGAAAGAGG - Intronic
1057533721 9:95877390-95877412 ATGTAATTTAAAAGGGAAAGGGG - Intronic
1057690476 9:97279264-97279286 CTCTAAGATTAAAAAGAAGGTGG + Intergenic
1057823015 9:98348058-98348080 GGGTAAATTAAAAAGGAAAGAGG - Intronic
1058367940 9:104232646-104232668 CTGTTATTTATAAAGGAAAGAGG + Intergenic
1058783356 9:108361884-108361906 GGGTAATTTATAAAGGAAGGAGG + Intergenic
1058940667 9:109809980-109810002 GGGTAATTTAAAAAGGAAAGAGG - Intronic
1059605121 9:115825770-115825792 GTGGAAGTTGAAGAGGAAGGAGG - Intergenic
1059743055 9:117171803-117171825 CGGTAATTTATAAAGGAAAGAGG - Intronic
1060699057 9:125734940-125734962 GTGTAATTTATAAAGAAAGGAGG + Intergenic
1061618533 9:131795776-131795798 CTGTAATTTATAAAGAAAAGAGG + Intergenic
1203636933 Un_KI270750v1:121670-121692 GGGTAATTTACAAAGGAAGGAGG + Intergenic
1185938748 X:4289108-4289130 GTGTAATTTATAAAGGAAAGAGG - Intergenic
1186028808 X:5344898-5344920 CTGAAAGTTAAAAAGCAAATTGG + Intergenic
1186143638 X:6603082-6603104 GTGTAATTTATAAAGGAAAGAGG - Intergenic
1186260142 X:7769025-7769047 GTGTAATTTATAAAGGAAAGAGG + Intergenic
1188527947 X:31106567-31106589 CTGTAATTTATAAAGGAAAGAGG + Intronic
1188584917 X:31762213-31762235 CTGTACTTTAAAATGGAAGAAGG - Intronic
1188918546 X:35942737-35942759 CTGTAAGTAAAAAAGGAATATGG + Intronic
1189078875 X:37947548-37947570 GTGTAATTTATAAAGGAAAGAGG - Intronic
1189137788 X:38567240-38567262 CTGTAATTTATAAAGGAAAGGGG + Intronic
1189905307 X:45753393-45753415 CTGGAATGTAAAAAGGAAGCAGG + Intergenic
1190182185 X:48202249-48202271 TTGTAAATTTAAGAGGAAGGAGG + Intronic
1190183159 X:48211211-48211233 CTGTAAGTGGAGAAGGAGGGAGG + Intronic
1190467009 X:50734995-50735017 GGGTAACTTATAAAGGAAGGAGG - Intronic
1190590908 X:51999788-51999810 GGGTAATTTAAAAAGGAAAGTGG - Intergenic
1190959011 X:55227184-55227206 GGGTAATTTATAAAGGAAGGAGG - Intronic
1192240989 X:69328178-69328200 GGGTAATTTATAAAGGAAGGAGG - Intergenic
1192657361 X:73004759-73004781 CGGTGTGTTAAAAGGGAAGGCGG - Exonic
1192664760 X:73078248-73078270 CGGTGTGTTAAAAGGGAAGGCGG + Exonic
1193963804 X:87958344-87958366 CTGTAATTTATAAAGAAAAGAGG - Intergenic
1194049498 X:89052186-89052208 GTGTAATTTATAAAGGAAAGAGG + Intergenic
1194386717 X:93264336-93264358 CGGTAATTTATAAAGGAAAGAGG - Intergenic
1194443056 X:93955997-93956019 GGGTAATTTAAAAAGGAAAGAGG - Intergenic
1194447353 X:94004897-94004919 CTGTAATTTATAAAGGAAAAAGG - Intergenic
1194861375 X:99002769-99002791 TTATAAGTAAAAAAGGAAGATGG + Intergenic
1195179817 X:102346994-102347016 GTGTAATTTATAAAGGAAAGAGG + Intergenic
1195457503 X:105085094-105085116 CTGTAATTTATAAAGGAAAGAGG - Intronic
1195502765 X:105621661-105621683 GTGTTAGTCAAAAGGGAAGGGGG + Intronic
1195851333 X:109285097-109285119 ATGTTAGTTAAAAATTAAGGAGG - Intergenic
1196228275 X:113190581-113190603 GTGTAATTTATAAAGGAAAGAGG - Intergenic
1196460588 X:115925063-115925085 CTGTAATTTACAAAGAAAAGAGG - Intergenic
1196528243 X:116751763-116751785 CTTTAATTCAAAAAGGAAAGTGG - Intergenic
1196864162 X:120055634-120055656 GGGTAATTTATAAAGGAAGGAGG - Intergenic
1196878937 X:120180696-120180718 GGGTAATTTATAAAGGAAGGAGG + Intergenic
1196903136 X:120406335-120406357 CCGTGAGTTAAAGAGGAAGGGGG - Intergenic
1197040910 X:121933919-121933941 CTGTAATTTATAAGGGAAAGAGG + Intergenic
1197333807 X:125186751-125186773 GTGTAATTTATAAAGAAAGGAGG - Intergenic
1197356078 X:125438647-125438669 CTGTCACATCAAAAGGAAGGAGG - Intergenic
1197426776 X:126306146-126306168 GGGTAATTTAAAAAGGAAAGAGG - Intergenic
1198564899 X:137894349-137894371 GGGTAATTTATAAAGGAAGGAGG + Intergenic
1198941592 X:141963115-141963137 GGGTAATTTATAAAGGAAGGAGG + Intergenic
1199001722 X:142646801-142646823 CTTTAAGTTGAAGAGGAAAGGGG + Intergenic
1199219464 X:145300904-145300926 GTGTAATTTATAAAGGAAAGAGG + Intergenic
1199376756 X:147121785-147121807 CTTTAAGTTAAAAATGATGTTGG - Intergenic
1199909427 X:152270383-152270405 CTGTAATTTATAAAGGAAAGAGG - Intronic
1200382175 X:155849411-155849433 CTGTAATTTATAAAGAAAAGAGG - Intergenic
1201276984 Y:12308135-12308157 CGGTAACTTATAAAGGAAAGAGG - Intergenic
1201298578 Y:12486766-12486788 TTGGCTGTTAAAAAGGAAGGGGG - Intergenic
1201468868 Y:14313090-14313112 CTGTTTGTTAAACAGGGAGGAGG - Intergenic
1201624909 Y:16004216-16004238 GTGTAATTTATAAAGGAAAGAGG - Intergenic
1201643039 Y:16199398-16199420 CTATAAGTCAAAAAGGAAGGAGG + Intergenic
1201659776 Y:16385923-16385945 CTATAAGTCAAAAAGGAAGGAGG - Intergenic
1202588142 Y:26453790-26453812 ATTTAAGTTAAAAAGGGAAGTGG - Intergenic