ID: 1003135073

View in Genome Browser
Species Human (GRCh38)
Location 6:3428700-3428722
Sequence GTTGTGAAGGGCTTCCTTAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 117
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 111}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1003135073 Original CRISPR GTTGTGAAGGGCTTCCTTAT TGG (reversed) Intronic
906119247 1:43377157-43377179 GTGGTGAAGGGCCTCCTTTAGGG + Intergenic
906443066 1:45867677-45867699 GATGTGGAGGACTTTCTTATTGG + Intronic
909147395 1:71953728-71953750 TTTGTGAAGGGCTTACTGACTGG - Intronic
909567231 1:77066869-77066891 GCTGTTAAGGTCTTCCTTGTAGG + Intergenic
909895164 1:81059601-81059623 TTTTGTAAGGGCTTCCTTATGGG + Intergenic
914836769 1:151213239-151213261 GTGGAGCAGGGCTACCTTATAGG + Intronic
915478073 1:156165687-156165709 GTGGAGCAGGGCTACCTTATAGG + Intronic
921655669 1:217733925-217733947 TTTGTGAAGGGCTGCCCTAATGG + Intronic
922353349 1:224753697-224753719 CTTCTGAAGGGCTCCCTCATAGG + Intergenic
923153523 1:231255843-231255865 GTTGTAAATGACTTCCTTATGGG + Intronic
923771640 1:236942711-236942733 GTTGTGAAGGTATTTTTTATAGG - Intergenic
1063658230 10:8012731-8012753 GTAGTGATGGGCTTCCTTTAAGG - Intronic
1065239399 10:23690384-23690406 TTTAAGAAGGGCTTCCTTAAAGG - Intergenic
1067781093 10:49208082-49208104 GTTGGGAAGGGCTTTCTCAAGGG + Intergenic
1074723213 10:116281732-116281754 GGTGAGAATGGCTTCCTCATGGG + Intergenic
1077099868 11:817769-817791 GTTCTGGAGGGCTTCCCTGTGGG - Intergenic
1079272908 11:19005505-19005527 GATGTGAGGGGCTTCCTCAAAGG - Intergenic
1080667846 11:34351397-34351419 GTTGTGAAGCCCTTCCTCTTGGG + Intronic
1080969312 11:37251552-37251574 GTTGCTAATGGCTTCCATATTGG + Intergenic
1081755330 11:45540279-45540301 CTTGTGAAGTGCTTGCATATTGG + Intergenic
1083912738 11:65719685-65719707 GCTGTGAAGAGCTCCTTTATTGG + Exonic
1089857877 11:121562712-121562734 GTTGTAAAGTGCTTCCTTTAGGG + Intronic
1090705662 11:129333920-129333942 GGTGAGTAGGGCTTTCTTATAGG - Intergenic
1090910445 11:131113999-131114021 TTTATGATGGGCTTCCTGATTGG + Intergenic
1092247202 12:6870309-6870331 GATGTGGATGGCTTCCTTGTGGG + Exonic
1094504406 12:31049331-31049353 CTGGTGAAGTGCCTCCTTATTGG - Intergenic
1094800318 12:34025422-34025444 GTTATGAAGGATTTCCTTAAAGG + Intronic
1095113106 12:38319725-38319747 GTTATGAAGGATTTCCTTAAAGG + Intronic
1095342699 12:41110797-41110819 GGTGTGAAGGGCTTTATTAGAGG - Intergenic
1096770522 12:53933460-53933482 TTTCTGAAGGGCTTCCTAAAAGG + Intergenic
1097337042 12:58394968-58394990 GTTGAGAAGGGCCTACTTGTTGG - Intergenic
1099982616 12:89624259-89624281 TTTGTGAAGTTCTTCATTATTGG - Exonic
1102015171 12:109643549-109643571 GGGGTGCAGGGCTTCCTTCTGGG - Intergenic
1102782036 12:115573609-115573631 GTTTTGAAGGGATTCCTTCATGG + Intergenic
1106935145 13:34710206-34710228 GTGGTTAATGGCTACCTTATTGG + Intergenic
1107460008 13:40592911-40592933 GCTGTGAAGTGATTGCTTATTGG - Intronic
1108560114 13:51634896-51634918 AATGTTTAGGGCTTCCTTATGGG - Intronic
1120365369 14:83561679-83561701 ATTGGGCAGGGCTTCCCTATAGG + Intergenic
1122019270 14:98822940-98822962 ATTGGAAAGGGCTTCCATATTGG + Intergenic
1122589619 14:102838357-102838379 GTTGTGATGGGTGTCCTTACAGG + Intronic
1124667476 15:31605558-31605580 GCTGTGAGGGGCTTCCTATTGGG + Intronic
1125097804 15:35874603-35874625 GTTTTGAAGGGCCTCCTGCTGGG + Intergenic
1125711603 15:41791454-41791476 GTTAGGAAGGGCTTCCTGCTTGG - Intronic
1128565905 15:68700286-68700308 GCTGTGAAGAGCTTCCCTCTGGG - Intronic
1131010848 15:89017378-89017400 GCAGTGAAGGGATTCCTTAAGGG - Intergenic
1133707062 16:8364795-8364817 GTTTTGAAGGGCCTCCTCCTCGG + Intergenic
1133956356 16:10447183-10447205 GTGGTGAAGTGCTTCCTTGATGG - Intronic
1141798811 16:86293196-86293218 GTTGCGTAGGGTTTCCTTTTGGG + Intergenic
1142113679 16:88345409-88345431 GTGGCCCAGGGCTTCCTTATGGG + Intergenic
1146779706 17:35658319-35658341 GTTGGGAAGGGCTGCTTGATTGG + Intronic
1148761917 17:50008349-50008371 GTTGTAAAGGGCTACCTCATGGG - Intergenic
1149233910 17:54569099-54569121 ATTGTGAAGGACTACCTTTTGGG + Intergenic
1151366525 17:73620323-73620345 GGTGTGAAGTGTTACCTTATGGG - Intronic
1151555502 17:74844549-74844571 TTTGTGAGGGGGTTGCTTATAGG - Intronic
1152896520 17:82914422-82914444 GTGGAGAAGGGCATCTTTATGGG + Intronic
1153628112 18:7041016-7041038 TTTGTAAGGGGCTTCTTTATGGG + Intronic
1155355027 18:24943689-24943711 GCTCTGAATGGCTTCCCTATAGG + Intergenic
1156437739 18:37151865-37151887 GGTGAGGAGGGCTTCCATATGGG + Intronic
1157875919 18:51273773-51273795 GATGTGAAAGGGTTTCTTATGGG + Intergenic
1158386394 18:56997536-56997558 GTTGACAAGGTCTTCGTTATTGG - Intronic
1163115140 19:15184778-15184800 TTTGAGAGGGGCTTCCTTCTTGG - Intronic
1165420294 19:35718841-35718863 GTGGTGGAGGGCTTCCTCTTGGG + Intronic
925259001 2:2513194-2513216 GATGTGAAGGGCTTCATTCATGG + Intergenic
929769908 2:44883262-44883284 GCTGCTAAGGTCTTCCTTATGGG - Intergenic
930745049 2:54874296-54874318 GATCTGAAGGGCTGCCTTATGGG - Intronic
934855548 2:97727219-97727241 GTAGGGAAGGGATTCCTTAAGGG + Intronic
935291331 2:101613316-101613338 GATGTGAAGGGATTCCCCATGGG + Intergenic
935349056 2:102138106-102138128 GATGGGAAGGGCTGCCTTTTGGG + Intronic
938210346 2:129461554-129461576 GATGTGAAGGGTTTTCTTGTGGG - Intergenic
939182084 2:138815459-138815481 GTCGTGATTGGCTTCCATATTGG + Intergenic
940564488 2:155343523-155343545 GTGGTGAAGCGTTTCTTTATTGG - Intergenic
944856679 2:203774988-203775010 CTTTTGAAGAGCTTCCTAATAGG + Intergenic
945068939 2:205971785-205971807 GTTGTGAATGGGTTCCTTTCAGG + Intergenic
1170336798 20:15279159-15279181 GTTGTTAATGGCTTACATATGGG + Intronic
1171037902 20:21731077-21731099 GATGTGAAGGGCATCTTTCTGGG - Intergenic
1178240423 21:30893544-30893566 GTGGAGCAGGGCTACCTTATAGG - Intergenic
1182817458 22:33178295-33178317 GTTGTGCAGGGCTTCCTTTAAGG - Intronic
1184575171 22:45358073-45358095 GTTGTGAAGAGCTTCCAGGTTGG + Intronic
949684298 3:6550107-6550129 GAGGTGAAGTGCTTCTTTATAGG - Intergenic
950497373 3:13341859-13341881 GTTGTCAAGGGCTTCATCAAGGG + Exonic
950538253 3:13594364-13594386 GCTGTGATGGGCTTCTTTCTGGG + Intronic
956397696 3:68843226-68843248 GATGTGAAGGACGTCCTCATGGG - Intronic
956497832 3:69847825-69847847 GTTATGAAGGGCTTCCCCAATGG - Intronic
960846459 3:122008402-122008424 GTTGTGAAGGGGTTCTCTAGTGG + Intronic
961968397 3:130931198-130931220 GTTTTGAAAGGCTCCTTTATTGG + Intronic
969407461 4:7003301-7003323 GTTGGGAAGGGATTCCCTAGTGG + Intronic
975320689 4:73007181-73007203 GTAGTCAAAGCCTTCCTTATAGG + Intergenic
976055968 4:81067477-81067499 GTAGAGAAGGGCATCCTTAAAGG + Intergenic
982692528 4:158565046-158565068 GGTGAGAAGGGCATCCTTAGAGG + Intronic
986352367 5:6892546-6892568 GCTGTGAGGGGCTTTCTTCTAGG - Intergenic
991734112 5:69616009-69616031 GGCGTGAAGGGATTTCTTATGGG + Intergenic
991810546 5:70471144-70471166 GGCGTGAAGGGATTTCTTATGGG + Intergenic
991860155 5:71006139-71006161 GGCGTGAAGGGATTTCTTATGGG - Intronic
993442220 5:87971426-87971448 TTTGTGAAGTGCTTCCTCAGGGG + Intergenic
994518817 5:100803323-100803345 GTTGTTAAAGTCTTCCTAATGGG - Intergenic
997285262 5:132673348-132673370 CTTGCCAAGGGCTTCCTTATGGG + Intergenic
1003135073 6:3428700-3428722 GTTGTGAAGGGCTTCCTTATTGG - Intronic
1012440274 6:99255733-99255755 TTTGTGAATGGCTTTCTTTTGGG - Intergenic
1013311752 6:108901051-108901073 ATTGTGAAGGCCTTTCTTGTAGG + Intronic
1021179584 7:17490038-17490060 GCTCTGAAGACCTTCCTTATAGG - Intergenic
1021227075 7:18040304-18040326 TTTGTCAAGGCCTTCATTATTGG + Intergenic
1022812494 7:33883712-33883734 GTTGTGAAGAGTTTCCTGGTTGG - Intergenic
1027751712 7:82156333-82156355 GTTATAAAGGGCTTCCTGCTGGG - Intronic
1030085837 7:105814854-105814876 GTTCTGAATGGCTTCCTCCTGGG + Intronic
1035042523 7:155940351-155940373 TGTGTGAAGAGCTTTCTTATCGG + Intergenic
1038301869 8:26358543-26358565 ATTGGGAAGGGCATCCTTAGGGG + Intronic
1041195985 8:55401703-55401725 CTTGTGAATGGCTGCCTTAATGG - Intronic
1042804812 8:72759745-72759767 GTTCTGAATGGCATCCTCATGGG + Intronic
1043060345 8:75492531-75492553 GTGGTGAAGGCCATCATTATTGG - Intronic
1047059239 8:121205088-121205110 GTTGTTAATGGCTACCATATTGG + Intergenic
1053443462 9:38134426-38134448 GTGGTGAATGGCTACCGTATTGG + Intergenic
1193539092 X:82749043-82749065 ATTCTGAAGGGCTTACTTGTTGG + Intergenic
1195996102 X:110733164-110733186 CTTGTGATGTGCTGCCTTATAGG + Intronic
1196258302 X:113548584-113548606 GTGGTGAATGGATTCCTGATTGG + Intergenic
1197168890 X:123409500-123409522 GTTCTGAAGGGCTTACATAATGG - Intronic
1198715585 X:139555076-139555098 GTTGGAAAGGGCTTTCTTAATGG - Intronic
1199241419 X:145552188-145552210 GTTGAGAAGGGCTTGTTGATTGG - Intergenic