ID: 1003137905

View in Genome Browser
Species Human (GRCh38)
Location 6:3446997-3447019
Sequence CAGTGAGATCTCGCGTGGTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 59
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 53}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1003137905 Original CRISPR CAGTGAGATCTCGCGTGGTG GGG (reversed) Intronic
902690978 1:18109986-18110008 CAGGGAGAGCTCGCAGGGTGGGG - Intronic
904682942 1:32241386-32241408 CAGTGAGACGTGGCGGGGTGGGG - Intergenic
912505806 1:110155103-110155125 CACTGAGATCTCAGGTGGTTTGG - Intronic
912726816 1:112066018-112066040 CAGGGAGATCTTGCTTTGTGTGG + Intergenic
918629195 1:186695468-186695490 CAGTGAGATCTGGCCAGGCGCGG + Intergenic
921945448 1:220883094-220883116 CAGTCAAAGCTCGGGTGGTGGGG - Intronic
1063653832 10:7967167-7967189 CAGAGAGACTTCACGTGGTGAGG + Intronic
1067595503 10:47553947-47553969 GAGGGAGATCTCGCGTTCTGGGG + Intergenic
1068132229 10:52909124-52909146 CAGTGAGTTCTCATGTGATGTGG - Intergenic
1070886470 10:79904557-79904579 GAGGGAGATCTCGCGTTCTGGGG - Intergenic
1070895396 10:79979797-79979819 CAGTGAGATATCACCTGGAGTGG + Intronic
1074336072 10:112577119-112577141 CACTGAGTCCTCACGTGGTGGGG + Intronic
1075592841 10:123704968-123704990 CAGTGTCATCTCACGTGTTGAGG - Intergenic
1082869667 11:57932387-57932409 CAGAGAGATCTTGCTTGGTGAGG + Intergenic
1084849751 11:71929178-71929200 CAGTGAGGTATCGGGAGGTGGGG + Intronic
1092344612 12:7705163-7705185 AAGTAAGATCTCGCCGGGTGCGG + Intergenic
1092858372 12:12696265-12696287 CAGGCAGATCTCGCGTGGTTTGG + Intergenic
1107900005 13:45002430-45002452 CAGTGAGATCTCGCCTCTTAGGG + Intronic
1121683919 14:95817503-95817525 CAGTGATATCTCCTGAGGTGTGG + Intergenic
1122059492 14:99127102-99127124 CAGTGAGCTCTCCTGTGGGGTGG - Intergenic
1122177410 14:99931253-99931275 AAGTGAGATCTGGGGTGGGGAGG - Intronic
1122437847 14:101711766-101711788 GGGTGAGATCTCGCTGGGTGGGG - Intergenic
1122437852 14:101711786-101711808 GGGTGAGATCTCGCTGGGTGGGG - Intergenic
1122541297 14:102499038-102499060 CAGTGAGGTGTGGTGTGGTGTGG - Exonic
1125460364 15:39900947-39900969 CAGTGAGATATCAGGTTGTGAGG + Intronic
1144808631 17:17984446-17984468 CAGTGAGACCTGATGTGGTGTGG - Intronic
1148799783 17:50216521-50216543 CAGTGAGATCTTTAGTGGTTTGG + Intergenic
1158678788 18:59547744-59547766 CAGTGAGACCTCCAGTGGTGTGG + Intronic
936151507 2:110024540-110024562 AAGGGAGATCTCGTGTGGTCAGG + Intergenic
936193167 2:110346829-110346851 AAGGGAGATCTCGTGTGGTCAGG - Intergenic
948384633 2:237573915-237573937 CAGTGAGAGCTGGCGTGCAGAGG - Intergenic
1169314153 20:4574241-4574263 CACTGAGACCTCGAGAGGTGGGG + Intergenic
1175452783 20:59084167-59084189 CAGTGTGATCTGGCGTGAGGCGG + Intergenic
1175552047 20:59823713-59823735 AAGTGAGATCTGGGGAGGTGGGG - Intronic
1177423655 21:20894984-20895006 CAGTGAGTTCTCGCGAGATCTGG + Intergenic
1179568321 21:42262893-42262915 CAGTGAGCTCTGGCCTGGTGAGG + Intronic
1181981236 22:26768342-26768364 CAGTCAGATTTGGAGTGGTGCGG + Intergenic
1183406016 22:37631040-37631062 CAGTGAGAGCTCGGTTGGTACGG - Exonic
1184300341 22:43555180-43555202 CAGGGAGACCCAGCGTGGTGGGG + Intronic
1185147822 22:49148864-49148886 CATTGATCTCTCTCGTGGTGAGG - Intergenic
1185344948 22:50307066-50307088 CAGTGGGGTCTCGCCAGGTGCGG + Intronic
964708156 3:159643018-159643040 TAGTCAGATCTAGGGTGGTGAGG + Intronic
970430388 4:15983679-15983701 CAGTGAGATCTGGAATGGGGAGG + Intronic
970530391 4:16975507-16975529 CAGTGAGACCTGACCTGGTGAGG - Intergenic
987287327 5:16469646-16469668 CAGTGAGTTCTCTCAAGGTGTGG + Intergenic
993603529 5:89958464-89958486 CAGGTAGATCTCTCGAGGTGAGG + Intergenic
1001478248 5:172066144-172066166 CAGGGAGTTCTGGCATGGTGAGG + Intronic
1003137905 6:3446997-3447019 CAGTGAGATCTCGCGTGGTGGGG - Intronic
1011231136 6:85163723-85163745 CAGGGAGATCCTGCATGGTGGGG - Intergenic
1017124555 6:151052951-151052973 CACTGAGATCGCCCGTCGTGGGG + Intronic
1018647203 6:165959787-165959809 CAGAGAGATCTCGCCTGGGGAGG + Intronic
1019332997 7:470178-470200 CAGGGAGATATAGGGTGGTGGGG - Intergenic
1019333083 7:470424-470446 CAGGGAGATATAGGGTGGTGGGG - Intergenic
1019333214 7:470799-470821 CAGGGAGATATAGGGTGGTGGGG - Intergenic
1020213296 7:6171025-6171047 CAGTGGGACCCCGCGTGCTGGGG + Intronic
1058351286 9:104027692-104027714 CAGTGAGATCTAGGCTAGTGAGG + Intergenic
1185809218 X:3089553-3089575 CAGTGAAATCGTCCGTGGTGGGG - Exonic
1194055645 X:89128106-89128128 CAGGGAGATCTCACCTAGTGAGG + Intergenic
1197114723 X:122818531-122818553 CAGAGAGGTCTCGCCTAGTGAGG - Intergenic