ID: 1003138625

View in Genome Browser
Species Human (GRCh38)
Location 6:3453811-3453833
Sequence AAGTAGAAGCAGAAAGTGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 820
Summary {0: 1, 1: 0, 2: 7, 3: 70, 4: 742}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1003138625_1003138631 9 Left 1003138625 6:3453811-3453833 CCTTCCACTTTCTGCTTCTACTT 0: 1
1: 0
2: 7
3: 70
4: 742
Right 1003138631 6:3453843-3453865 GCTGACAAGCACCTGACCCCTGG 0: 1
1: 0
2: 0
3: 14
4: 308

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1003138625 Original CRISPR AAGTAGAAGCAGAAAGTGGA AGG (reversed) Intronic
900177708 1:1298165-1298187 AAGGTGAAGCAGGAAGTGGGTGG - Intronic
900704369 1:4070702-4070724 ATGTAGAATCAGAGAGAGGAAGG + Intergenic
900935307 1:5762221-5762243 AAAAAGAAGAATAAAGTGGAAGG - Intergenic
901185289 1:7368958-7368980 AAACAGAAGCAGAAGGAGGAAGG - Intronic
901266828 1:7917248-7917270 AAGTAGAAAAAGAAGGTGGAGGG + Exonic
902072736 1:13754603-13754625 TAATAAAAGCAGAGAGTGGACGG + Intronic
902599912 1:17533945-17533967 AAGAAGAAGAAGAAAGTGGGTGG - Intergenic
904295762 1:29518859-29518881 AAGGAGAAGGAGAATGAGGAAGG - Intergenic
904308906 1:29612559-29612581 AAGAAGAAAGAGAAGGTGGAAGG - Intergenic
904437206 1:30506648-30506670 AAGTAGGAACAGCAAGTGGGAGG + Intergenic
904821895 1:33250893-33250915 AAGGAGAAGAAGAAGGTGCATGG + Intergenic
904974300 1:34444026-34444048 CAATGGAAGCAGAGAGTGGAGGG - Intergenic
905751483 1:40468406-40468428 AAGAAGAAAAAGAAACTGGATGG + Intergenic
905838495 1:41152006-41152028 TAGAAGAGGCAGAAAGTGGGTGG + Intronic
906109396 1:43312934-43312956 AAGGAGAAGCAGAAGCTTGAGGG + Intronic
906180896 1:43817827-43817849 AAGGAGAAGAAGAAGGAGGAAGG - Intronic
906182416 1:43833699-43833721 AATGAGAGGCAGAAAGGGGAAGG + Intronic
908295972 1:62713443-62713465 AAGAAGAAAGAGAAGGTGGAAGG - Intergenic
908420768 1:63956354-63956376 AAGCTGAAGAGGAAAGTGGATGG + Intronic
908577321 1:65474664-65474686 AAATAGAGGAAGAAAGTGGATGG + Intronic
908827398 1:68146856-68146878 AAGTTGTAGCAGAAAGGGGTTGG - Intronic
908871177 1:68614752-68614774 AAGTCCAAGCAGAATGTCGAGGG + Intergenic
909085812 1:71169168-71169190 AAGGAGAAGCACACAGTGGCAGG + Intergenic
909162017 1:72164035-72164057 AAGTAAAAGCAGAAACAAGAAGG + Intronic
909642971 1:77887904-77887926 AAGAAGAAGAAGAAAGTTGAAGG - Intergenic
909686546 1:78355211-78355233 AAGGAGGAGGAGAAAGGGGAGGG - Intronic
910002508 1:82356819-82356841 AAGTATAAGCATCAAGTGTAAGG + Intergenic
911594944 1:99788831-99788853 GAGTAGAAACAGAATGAGGAGGG - Intergenic
911663246 1:100527150-100527172 AAGAAGAAGAAGAAAGAAGAAGG - Intergenic
912228636 1:107766238-107766260 AAGAAGAAGAAGAAGGAGGAGGG - Intronic
912285589 1:108365157-108365179 GAGTGGGAGCAGAAAGAGGAAGG - Intergenic
912524430 1:110270669-110270691 AAATAGAAGCAGTATGTGCAAGG + Intronic
912710805 1:111948508-111948530 AAGAAGAAAGAGAAAGTAGAAGG - Intronic
913252924 1:116927085-116927107 AAACAGAAGCAGAAAGAGCAAGG + Intronic
913303133 1:117394567-117394589 AAACAGAAGAAGAAAGTGAATGG - Intronic
913577329 1:120189831-120189853 AAGTAGAAGAACAAAGTTGGAGG + Intergenic
913968834 1:143398533-143398555 AAGAGGAAGCAGCAAGTGCAAGG - Intergenic
914063213 1:144224132-144224154 AAGAGGAAGCAGCAAGTGCAAGG - Intergenic
914115937 1:144742222-144742244 AAGAGGAAGCAGCAAGTGCAAGG + Intergenic
914559242 1:148801258-148801280 AAGTAGAAGAACAAAGTTGGAGG + Intergenic
914613591 1:149328965-149328987 AAGTAGAAGAACAAAGTTGGAGG - Intergenic
914687067 1:149989746-149989768 AAGAAGAAGAAGAAGGTGGGGGG + Intronic
914956322 1:152165886-152165908 AAACAGAAACAGGAAGTGGAGGG - Intergenic
915086314 1:153391242-153391264 TAGGAGAAGCGGAAAGAGGAAGG + Intergenic
915789172 1:158649209-158649231 AACTAGAAGCTGACAGTAGAGGG - Intronic
915792635 1:158691103-158691125 AAGTAGAAGAAGAAAGTCAGAGG - Intergenic
915835993 1:159175150-159175172 AACTAGGAACAGAAACTGGATGG - Intronic
916078375 1:161216633-161216655 AAATAGAGGCAGAAATGGGAAGG + Intronic
916333734 1:163646524-163646546 AAGGAGAAGAACAAAGTTGAAGG - Intergenic
917230599 1:172833398-172833420 AAGTAGAAGCTGTTAATGGAAGG - Intergenic
917747311 1:178023200-178023222 TCGTAGAAACAGAAAGTGAATGG + Intergenic
917789732 1:178491917-178491939 GACTAGAATCAGACAGTGGATGG - Intergenic
918183976 1:182111125-182111147 AAGTGGAGGTAGAAAGTGGATGG + Intergenic
918460308 1:184769730-184769752 AAGTGGAAAGAGAAAGAGGAAGG + Intergenic
918496962 1:185150948-185150970 AAATGGAAGAAGGAAGTGGAAGG + Intronic
918617098 1:186557494-186557516 AAGAAGAGACAGAGAGTGGAGGG - Intergenic
918705203 1:187651958-187651980 CAGTAGAAGCTGAGTGTGGAGGG + Intergenic
918724493 1:187901839-187901861 AAGAGGAAGCAGTAAATGGAGGG - Intergenic
919559814 1:199102510-199102532 TCATAGAAGCAGAAAGTAGAAGG - Intergenic
919595845 1:199561519-199561541 AAGAAGAAGGAGAAGGAGGAGGG - Intergenic
920971819 1:210749332-210749354 AAGTAAAAGGAGATAATGGATGG + Intronic
921233794 1:213102402-213102424 AAGAAGAACCAAGAAGTGGAAGG - Intronic
921511659 1:216038493-216038515 AAATAGAATAAGAAAGTGGAGGG - Intronic
922408335 1:225342375-225342397 AATCAAAATCAGAAAGTGGAAGG + Intronic
922520100 1:226242790-226242812 GAGGAGAAGGAGGAAGTGGAGGG - Intronic
922522004 1:226261823-226261845 AAGTAGAAGAACAAAGTTGAAGG + Intronic
922912720 1:229231081-229231103 AGGTAGAAGCAGAAATTAGGCGG + Intergenic
923714243 1:236411512-236411534 AAGAAGAAGAAGAAAGAAGAAGG - Intronic
924119678 1:240783670-240783692 AAGTAATAACAGAAAGTTGATGG + Intronic
924537131 1:244945308-244945330 TCATAGAAACAGAAAGTGGAAGG + Intergenic
924680363 1:246224879-246224901 AAACAGAAGCAGAAAAAGGAAGG + Intronic
1063228446 10:4039682-4039704 AATAAGAAGAAGAAAGAGGAGGG - Intergenic
1064295803 10:14078257-14078279 AAGTAGGAGAAGAACCTGGAGGG + Intronic
1064896371 10:20241907-20241929 AAATAGAATCAGACACTGGATGG + Intronic
1065066096 10:21966667-21966689 AAGAAGAAGAAGAAAGAGGTGGG - Intronic
1065277714 10:24102593-24102615 AAGGAGAAGAACAAAGTCGAAGG + Intronic
1065478864 10:26172092-26172114 AAGTAGAGGCAGAAAGTCAAGGG + Intronic
1065588096 10:27240242-27240264 CACTAGAACCAGAAAGTGAAAGG + Intronic
1065718923 10:28605782-28605804 AAGTTGGAGAAGAAAGTGCAAGG - Intronic
1065722764 10:28642498-28642520 TAGTAGAAGAAGAAAGAGGTAGG - Intergenic
1065736560 10:28758296-28758318 AAGTAGAGACAGAAGGAGGAAGG - Intergenic
1065900850 10:30206664-30206686 AAGTAGAAGGTGAAAGAGAATGG + Intergenic
1066259634 10:33716648-33716670 AAGGGGAAGAAGAAAGAGGAAGG - Intergenic
1066331300 10:34426383-34426405 AAGCACATGCAAAAAGTGGATGG - Intronic
1066473402 10:35721530-35721552 ATGTAGAAGTAGAAAATGAAAGG + Intergenic
1066627940 10:37428347-37428369 AAGAAGAAGAAGAAAGAGAAAGG + Intergenic
1067150792 10:43731666-43731688 AAGCAGAAACAGAAGGAGGAAGG - Intergenic
1067752250 10:48979337-48979359 AAGTGGAAGCAGATATGGGAGGG - Intronic
1067920361 10:50449559-50449581 AAGGACATGAAGAAAGTGGAGGG - Intronic
1068123946 10:52814770-52814792 AAGTAGAAGGAAAAAGAAGAAGG - Intergenic
1068620957 10:59182140-59182162 AAGGAAAACCAGAAAGTAGAAGG - Intronic
1068817106 10:61329429-61329451 AAGGAGAAGAACAAAGTTGACGG - Intergenic
1069145020 10:64880812-64880834 AAGAAAAAGCAGAATGTGGAAGG + Intergenic
1069249308 10:66247209-66247231 AAGAAGAAGTAGAGAATGGAAGG + Intronic
1069769734 10:70890551-70890573 TGGTAGCAGCAGAAAGTTGAAGG - Intergenic
1069950708 10:72016340-72016362 AAGAAGAAAAAGAAAGAGGAAGG + Intergenic
1069987326 10:72293308-72293330 AAGAGGAAGCAGAATGGGGAGGG - Intergenic
1070456763 10:76624771-76624793 GAGTAGGAGAAGAAAGGGGACGG - Intergenic
1070485454 10:76926285-76926307 AATTAGAAACAGAAAGAGGCAGG - Intronic
1070902931 10:80046718-80046740 ATGTAGAAGAAGGAAGGGGAAGG + Intergenic
1072085630 10:92076755-92076777 AAGTAGAAGAAGGAAGAAGAAGG + Intronic
1072905479 10:99449339-99449361 AAGTCTAGGCAGAAGGTGGAAGG + Intergenic
1073931115 10:108578232-108578254 AAATAGAAGCAGATTGTGGGTGG + Intergenic
1074402550 10:113153876-113153898 AAGTATGAGAAGAAAGAGGAAGG - Intronic
1074724522 10:116294567-116294589 AGGTAGCATCAGACAGTGGAGGG - Intergenic
1074874265 10:117602173-117602195 AAGTAGATGGAGAAAAGGGAAGG + Intergenic
1075291978 10:121238489-121238511 AAGGAGAAGCATAAAGGAGATGG - Intergenic
1075418266 10:122281707-122281729 ACCAAGAAGCAGAAAATGGAAGG + Intronic
1075627771 10:123974930-123974952 AAGCAGAAGGTGACAGTGGAAGG + Intergenic
1075695307 10:124430303-124430325 AAGTAGAAGGCTAAAGTGGGAGG - Intergenic
1076038126 10:127218679-127218701 AAATAACAACAGAAAGTGGAGGG - Intronic
1076333114 10:129686146-129686168 CAGCAGAAACAGAAACTGGAGGG + Intronic
1076574849 10:131457760-131457782 CAGTGGAAGATGAAAGTGGATGG + Intergenic
1077203215 11:1324502-1324524 AAGGAGAAGGAGGCAGTGGAAGG + Intergenic
1078249721 11:9607141-9607163 CAGTTAAAGCAGAAAGTGGAGGG + Intergenic
1078414579 11:11155013-11155035 AAGGAGAAGCAGAGAGTGGTGGG + Intergenic
1078696175 11:13634349-13634371 CAGTAGAAGCAGAAACTCCAAGG + Intergenic
1078841525 11:15080001-15080023 AAATAGAAGTCGAAATTGGAAGG + Intronic
1079615358 11:22486108-22486130 AAGGAGAAGGAGAAAGTGCAAGG + Intergenic
1079799917 11:24855670-24855692 AACAAGAAGAACAAAGTGGAAGG + Intronic
1079885021 11:25976731-25976753 GAGGAGAAGCAGAAAGAGAAGGG + Intergenic
1080421507 11:32115271-32115293 AAGAAGAAGCAAAGAGTGGAAGG - Intergenic
1081029505 11:38060724-38060746 AAGTACCAGCAGAAAGTGAAAGG + Intergenic
1081141500 11:39506547-39506569 GAGTAGAGGCAGAAATTGTAGGG + Intergenic
1081794733 11:45811502-45811524 AAGTAATATCAGAAAGTTGAAGG + Exonic
1083014075 11:59433826-59433848 AAATAGAAGAACAAAGTTGAGGG + Intergenic
1083551050 11:63590470-63590492 AAGGATAAGCAACAAGTGGAAGG + Intronic
1085280119 11:75324718-75324740 AAGTCGCAGCAGAAAGGGAAGGG - Intronic
1085629191 11:78099134-78099156 AAGTAGAAGATGAATTTGGATGG - Intergenic
1085685216 11:78615459-78615481 AGGTAGAAGAAGAATATGGAAGG - Intergenic
1085713354 11:78850690-78850712 AGGTGGAAGGAGAAAGAGGATGG + Intronic
1086079574 11:82889397-82889419 AAGAAGAAGGAGAAGGAGGAGGG + Intronic
1086283157 11:85214190-85214212 AAGTAGCAGCTGAAAGGAGAGGG - Intronic
1086409711 11:86532000-86532022 AACCAGAAACTGAAAGTGGAGGG + Intronic
1086457073 11:86969531-86969553 AGGAAGAAGGAGAAAGGGGATGG - Intergenic
1086474473 11:87156297-87156319 AAAAAGAAGAAGAAAGTTGAAGG - Intronic
1086514591 11:87597053-87597075 TAATGGAAGCAGAAATTGGAGGG + Intergenic
1086825525 11:91490363-91490385 AGGAAGGAGCAGAAAGAGGAAGG - Intergenic
1086855440 11:91860106-91860128 ATGTGGAAGAGGAAAGTGGAGGG - Intergenic
1086998927 11:93393024-93393046 AAGTAGAAGGAGGAGGAGGAGGG - Intronic
1087000549 11:93415622-93415644 AAGCAGAAGTAGAGACTGGAAGG - Intronic
1087282044 11:96221971-96221993 AAGTAGAAACGGAAACTGGGAGG - Intronic
1087548240 11:99612272-99612294 AAGATGCAGCAGAAAGTGAATGG + Intronic
1087624940 11:100585477-100585499 AAGCAGAGGCAGAGAGAGGATGG - Intergenic
1087940724 11:104093753-104093775 AAGGAGAAGGAGAAGGTGGGTGG - Intronic
1088039861 11:105366867-105366889 AAGTAGAAGCTGTAAGAAGAGGG - Intergenic
1088207109 11:107404831-107404853 GAGTAGAAGAGGAAAGTAGAGGG - Intronic
1088804207 11:113336783-113336805 AAGTAGAGGAACAAAGTTGAAGG - Intronic
1089113046 11:116072212-116072234 AATTAGAAGCAGACAGGGAAAGG - Intergenic
1089126017 11:116177142-116177164 AAGATGTAGCAGAAAGAGGAGGG + Intergenic
1089745370 11:120613219-120613241 AAGAAGAAACAGAAAGTGTGAGG - Intronic
1090892710 11:130940398-130940420 AAGGAGAAGAACAAGGTGGAAGG + Intergenic
1091337143 11:134780705-134780727 GAGAAGAAGGAGAAAGAGGAGGG - Intergenic
1091394314 12:144191-144213 ATGGAGAAGCAGAAAGTGGCAGG + Intronic
1091809430 12:3383156-3383178 AAATAGAAGAATAAAGTGGGAGG - Intronic
1092067508 12:5604129-5604151 AGGTAGAATTAAAAAGTGGATGG + Intronic
1092388890 12:8057776-8057798 AAGTGGAAGGAGAAAGAGGGTGG - Intergenic
1092749368 12:11704289-11704311 AAGGAGAAGAAGGAAGTGGAGGG + Intronic
1092846905 12:12592037-12592059 CAGGAGAAGTAGAAAGTGGCTGG - Intergenic
1093117753 12:15232993-15233015 AAGTAGAAGCAAAAACTGGTAGG + Intronic
1093698953 12:22195953-22195975 ACATAGAAGCAGAAAGAGGCAGG + Exonic
1094306862 12:29029711-29029733 AAGTATAAGAATAAACTGGATGG - Intergenic
1094369497 12:29722004-29722026 ATATAGAAGCAGATAGTAGAAGG - Intronic
1095154971 12:38841857-38841879 AGGGAGAAGCAGAAAGATGAAGG + Intronic
1095452300 12:42345054-42345076 AAGTAAAAGCACCAAGTTGATGG - Intronic
1096087248 12:48874013-48874035 AAGAAGAAGAAGAATGAGGAGGG + Intergenic
1096528423 12:52228139-52228161 AAGGAGAAGAAGAAGGAGGAGGG - Intergenic
1096729982 12:53601660-53601682 AAATAGAATCAGAAGGGGGAAGG - Intronic
1097022390 12:56029550-56029572 AAGTGGATGGAGAAAGTAGAGGG - Intronic
1097125354 12:56770230-56770252 AAGTGGAAGGAGACAGTGAAAGG - Intronic
1097306066 12:58070568-58070590 AAGTAGAATCTGATAGTGGTTGG - Intergenic
1097341091 12:58439015-58439037 AAGAAGAAGGTGGAAGTGGAAGG + Intergenic
1097658286 12:62396649-62396671 AAGGGGAAGGAGAACGTGGAGGG - Intronic
1098495425 12:71129550-71129572 AAGGTGAAGCAGGGAGTGGAAGG - Intronic
1098495878 12:71135279-71135301 AAGAAGAAGAAGAAGGAGGAGGG + Intronic
1098568227 12:71959078-71959100 CAGTATAAGCAGGAAGAGGAGGG - Intronic
1098701310 12:73631187-73631209 AAGAAGAAGGAGAAGGAGGAGGG + Intergenic
1098905630 12:76159172-76159194 GAGAAGAAACAGAGAGTGGATGG - Intergenic
1099507410 12:83496577-83496599 AAGTAGAATCAGAGAATAGATGG - Intergenic
1099610490 12:84862183-84862205 AGAAAGAAGCAGAAATTGGAAGG - Intronic
1099791848 12:87345650-87345672 AAATAATAGGAGAAAGTGGAGGG + Intergenic
1100143118 12:91643168-91643190 TAATTGAAGCACAAAGTGGAGGG - Intergenic
1100550736 12:95644376-95644398 AAGGAGAAGAAGAAGGGGGAAGG - Intergenic
1100642665 12:96497337-96497359 AAGGAGAAGAAGAAAGTTGGAGG + Intronic
1100972300 12:100083402-100083424 ACATAGAAGTAGAAAGTGAAGGG + Intronic
1101994457 12:109514898-109514920 AAAAAGAAGAAGAAAGGGGATGG - Intronic
1102252012 12:111393950-111393972 AAGCAGAAGTAGAAAGCGGAGGG - Intergenic
1102867904 12:116388685-116388707 TAGTAGAAGCAGAAGGTTGTTGG + Intergenic
1102974978 12:117200190-117200212 AAGGAGAAGAAGAAAGAAGAAGG - Intergenic
1103600801 12:122053401-122053423 AAGAAGAAGGAGACAGTGCAGGG - Intronic
1103680663 12:122690966-122690988 AATAACAAGCAGAAAGAGGAAGG - Intergenic
1103793819 12:123490037-123490059 CAGGAGAAGGAGAAAGGGGATGG - Intronic
1103854063 12:123952777-123952799 AAGTGGAAGCAAAAAGTAGAAGG + Intronic
1104184189 12:126413266-126413288 AAGAAGAAAAGGAAAGTGGAAGG + Intergenic
1104722591 12:131053244-131053266 AAGTGGAAGCAGACAGCAGAGGG - Intronic
1105967745 13:25399850-25399872 AAGAAGAAGATGAAAGAGGAGGG - Intronic
1106184820 13:27400126-27400148 AAGTGGAAGCAAAAGATGGAAGG + Intergenic
1106376440 13:29193187-29193209 AAGTATAGTCAGAAAGTGGGAGG - Intronic
1106820295 13:33456907-33456929 TAGTTGAAGCAGAAACTGTAAGG + Intergenic
1106966774 13:35080502-35080524 AAGTCCAAGCTGAAATTGGAGGG + Intronic
1107160420 13:37219524-37219546 AAGGAGAAGAACAAAGTTGAAGG - Intergenic
1107322439 13:39203906-39203928 AAGAAGAAACAGAAATTGGGAGG + Intergenic
1108026905 13:46187511-46187533 AAGTAGACAAAGAAAGTGGATGG - Intronic
1108687022 13:52828529-52828551 AAATAGATGCAAACAGTGGAGGG - Intergenic
1109599567 13:64606724-64606746 AAAAAGAACCAGAGAGTGGAAGG + Intergenic
1110514348 13:76392237-76392259 AAATATAAGCAGAGAGTAGAAGG + Intergenic
1111004994 13:82236015-82236037 AACTAGAAGTAGAAAGAGCATGG - Intergenic
1111739715 13:92188788-92188810 ATGCTGAACCAGAAAGTGGAAGG - Intronic
1111780387 13:92716238-92716260 AGGAAGTAGCAGAAAATGGAGGG - Intronic
1112125797 13:96466462-96466484 TCGTAGAAGCAGAAAATTGAAGG - Intronic
1112383761 13:98918793-98918815 AAGTAGAACAAGAAAGAGGAAGG + Intronic
1112422712 13:99267613-99267635 AAGCAGCAGTAGCAAGTGGAAGG - Intronic
1112732161 13:102376454-102376476 GAGGAGAGGCAGACAGTGGAAGG - Intronic
1112946717 13:104937115-104937137 GAATATAAGCAGAAACTGGAAGG - Intergenic
1113108087 13:106792586-106792608 AATTCACAGCAGAAAGTGGAAGG + Intergenic
1113241273 13:108340322-108340344 AAGCAAAAGCAGGAGGTGGAAGG + Intergenic
1114163474 14:20194927-20194949 AACTCAAAGCAGACAGTGGACGG - Intergenic
1114392226 14:22322368-22322390 AAGAAGAAGGAGAAAGAGAAAGG + Intergenic
1114652205 14:24292384-24292406 CAGTAGAAGCAGAGAGGGCAGGG - Intronic
1115018529 14:28646379-28646401 AAGAAGAAGAAGAAAGGAGAAGG + Intergenic
1115275589 14:31605751-31605773 AAGGAGAAGGAGAAGGAGGAAGG - Intronic
1116083665 14:40206799-40206821 AAGTAGAAACAGAAAGTGTAGGG - Intergenic
1116255843 14:42554258-42554280 GAGGAGAAGAAGAAAGAGGAAGG + Intergenic
1116919714 14:50560346-50560368 CCACAGAAGCAGAAAGTGGAGGG - Intronic
1117242885 14:53853093-53853115 AAGGAGAAGGAGAAAGAGGAGGG - Intergenic
1117651459 14:57910720-57910742 AAGGAGAAGCACAAAGTTGGAGG - Intronic
1117680109 14:58195176-58195198 AAATAGAACCAGAAAGGGCACGG + Intronic
1118375320 14:65171777-65171799 AAGAAGAAGAAGAAGCTGGAAGG + Intergenic
1119128397 14:72149674-72149696 AAGTAGAAGCAAACAGTGACTGG + Intronic
1119144351 14:72297211-72297233 AAATAGAAGAACAAAGTTGAAGG - Intronic
1119446215 14:74665632-74665654 AAGTAGAGGCAGAAGCTGAAGGG - Intronic
1119631668 14:76237482-76237504 AGGCAGGAGCAGAAAGGGGAAGG - Intronic
1119925383 14:78488764-78488786 ATGAAGAAGAAGAAAGGGGAGGG + Intronic
1120222139 14:81746724-81746746 AAGGAAAAGCAGAAAGGGGGTGG - Intergenic
1120655856 14:87189132-87189154 AAGCAGAAGGAGAATTTGGATGG - Intergenic
1121782619 14:96631681-96631703 ATGTAAAAGCAGAAAGGTGATGG - Intergenic
1121940558 14:98066413-98066435 AAGTGGAAGGTGACAGTGGATGG + Intergenic
1122011671 14:98754345-98754367 AAGTAGAAACAGAGGGTGGAAGG + Intergenic
1122038161 14:98963298-98963320 AAGGAGAAGGAGAAAGAAGAAGG + Intergenic
1122662164 14:103303720-103303742 AAGAAGAAGCAGCTAGGGGAAGG + Intergenic
1122685066 14:103500120-103500142 ATGTAGAAGCAGAGAGAAGAGGG - Intronic
1125713238 15:41804134-41804156 AAAAATAAGCAGAAAGTGGCCGG - Intronic
1126690050 15:51281925-51281947 AAATGGAAGCAGAAAGGGAAGGG + Intronic
1126866311 15:52941162-52941184 AAGCAGAAGCATAAGGTGAAAGG - Intergenic
1128095748 15:64953691-64953713 AAGGAGAAGAAGAAAGAAGAAGG - Intronic
1128304201 15:66587181-66587203 AAGGAGAAGCAGGAGGAGGAGGG - Intronic
1128877210 15:71212150-71212172 GAGTAGAAACAGAAAGAGAAAGG - Intronic
1130241384 15:82196128-82196150 CAGAAGAAGCAGACAGTGAAGGG + Intronic
1130795137 15:87199860-87199882 AAGAAAAAGAAGAAAGAGGAAGG + Intergenic
1130898353 15:88188202-88188224 AATCAGAAACAGAGAGTGGAGGG + Intronic
1131657100 15:94472520-94472542 AAGTAGATGCAAAAAGTTGTTGG - Intronic
1132085255 15:98903310-98903332 AAGAAGAAGGAAAAAGTAGATGG + Intronic
1133194424 16:4158832-4158854 AAGGAGGAGAAGAAAGAGGAAGG + Intergenic
1134638648 16:15811601-15811623 CAGTAGAGGCAGAGAGAGGAAGG - Intronic
1135175508 16:20224524-20224546 TATAAGAAGAAGAAAGTGGACGG + Intergenic
1135295730 16:21278009-21278031 AAGGAGGAGCAGGAAGAGGAGGG - Intronic
1135604002 16:23807546-23807568 AAGAAGAAGAAGAAAATAGAAGG - Intergenic
1135845262 16:25912939-25912961 AATCAGAATCACAAAGTGGAGGG + Intronic
1135963420 16:27016402-27016424 AAGAAGAAGGAGGAAGTGGGGGG - Intergenic
1136079033 16:27839458-27839480 AAACAGAAGCAGAAAGCGCAAGG + Intronic
1136240078 16:28938157-28938179 AAGAAAAAGAAGAAACTGGAGGG - Intronic
1137667078 16:50257261-50257283 ACTCAGAAGCAGCAAGTGGAAGG + Intronic
1137720406 16:50624539-50624561 AATTGGAAACAGGAAGTGGAGGG - Intronic
1137884396 16:52086926-52086948 CACTAGAAGCAGAAGGAGGAGGG + Intergenic
1137930946 16:52587065-52587087 AAGTTGTAGCAATAAGTGGATGG - Intergenic
1138091940 16:54181987-54182009 AAGAAGAAGAAGAAGTTGGAGGG - Intergenic
1139090681 16:63643249-63643271 AAGTAGAAGGAGAAAATACATGG - Intergenic
1139813826 16:69649406-69649428 AAGTAGAAGCAGAAAAATGAAGG - Intronic
1141368890 16:83469121-83469143 CAGCAGAAGCAGAAAGTTCAAGG + Intronic
1141372406 16:83500367-83500389 AAGAAGAAGAAGAAAGAAGAAGG - Intronic
1141514594 16:84535193-84535215 AAGGAGAAGGAGGAAGAGGAGGG - Intronic
1141537903 16:84696003-84696025 AAATAGAAGCAGAAAGAGAGAGG - Intergenic
1143174138 17:4947175-4947197 AAGCAGAAGCGGAGAGGGGAAGG + Intronic
1143391364 17:6561092-6561114 AAGGAGAAGGAGGAAGAGGAAGG - Intergenic
1143395407 17:6590978-6591000 AAGAAGAAGAAGAAAGAAGAAGG + Intronic
1143458052 17:7080441-7080463 ATGTAGAGGCAGGAAGTGAAAGG - Intergenic
1143715705 17:8767205-8767227 AAGGAGAAAAAGAAAATGGATGG - Intergenic
1145262360 17:21361970-21361992 TGGTAGAAGAAGAAAGAGGAGGG - Intergenic
1147000306 17:37358046-37358068 AAGTAGAAACAGAATCAGGAAGG + Intronic
1147260749 17:39208708-39208730 AGGGAGATGCAGAAAGAGGAGGG - Intergenic
1147337417 17:39735951-39735973 AAGTAGAAGCACAGAGGAGAGGG - Intergenic
1149103389 17:52933050-52933072 AAGAAGAAGCAGAAAGTCAAGGG + Intergenic
1149114164 17:53071726-53071748 AAGGAGAAGAAGAAAAAGGAGGG + Intergenic
1150423612 17:65058952-65058974 AAGAAGAAGAAGAAGGAGGAAGG + Intergenic
1150521793 17:65876003-65876025 CAGTAAAAGCAGAAAATGCAAGG - Intronic
1151466425 17:74288734-74288756 AAGGAGTTGCAGAAAGTGGGTGG + Intronic
1151815876 17:76471167-76471189 AGGTAGGAGGAGAAAGAGGAAGG + Exonic
1152793677 17:82295950-82295972 GAGTAAAAGCAGACAGTGGCCGG + Intergenic
1153274726 18:3357097-3357119 AGGTAGAACCAGAAAGTAAAAGG + Intergenic
1155865743 18:30962851-30962873 TATTATAAGCAGAAAGTGTATGG - Intergenic
1156036919 18:32774301-32774323 AAAAAGAAGCAGAAAAAGGAAGG + Exonic
1156217534 18:35015117-35015139 AAGTAAAGTCAGAAAGTGAAGGG - Intronic
1156535899 18:37864231-37864253 AATTTGTAGCAGAAAGTGGAAGG + Intergenic
1156842092 18:41620891-41620913 GAATTCAAGCAGAAAGTGGATGG + Intergenic
1157049632 18:44147168-44147190 AAGTAGATGAAGAAAAAGGAAGG + Intergenic
1157108350 18:44796024-44796046 GATTAGAAGCACAAATTGGAAGG - Intronic
1157422681 18:47559574-47559596 AAGGGGAAGGAGAAAGGGGAAGG - Intergenic
1157543883 18:48534201-48534223 AAGCAGAAGAAGTGAGTGGAGGG - Intergenic
1158114571 18:53980309-53980331 ATGTAGAAGGTGTAAGTGGATGG - Intergenic
1158126664 18:54107088-54107110 AAAAAGAAGAAGAAATTGGATGG + Intergenic
1158540974 18:58354367-58354389 AAGGACAAGAAGGAAGTGGAAGG - Intronic
1158613561 18:58965540-58965562 AAGCAGAAGTAAAAACTGGATGG - Intronic
1158701021 18:59746880-59746902 AAGTAGAAGGAGAAAGTTGGAGG - Intergenic
1159230616 18:65603905-65603927 AGGTAGAAGCAGTAATAGGAAGG - Intergenic
1159260682 18:66008037-66008059 AAGGAGAAGAACAAAGTTGAGGG - Intergenic
1159756059 18:72367594-72367616 AGAGAGAAGGAGAAAGTGGAAGG + Intergenic
1159783786 18:72690745-72690767 AAGTAGAAGCAGAAGGAAGCAGG + Intergenic
1159933083 18:74334305-74334327 AAGCAGAAGGGGAAAGAGGAAGG + Intronic
1160006858 18:75074516-75074538 AAATAGTGGCAGGAAGTGGAAGG - Intergenic
1161214298 19:3085727-3085749 AAGTAGAAGAGGAGAGGGGAGGG - Intergenic
1161351807 19:3797240-3797262 AAGAAAAAGTAGAAAGTGGGGGG - Intronic
1161370539 19:3908653-3908675 AAGGAGGAGAAGAAAGGGGAAGG - Intronic
1162108873 19:8389499-8389521 AAAGAATAGCAGAAAGTGGACGG + Intronic
1163072174 19:14853130-14853152 AAGTATAAGTACAAAGTGAATGG + Intergenic
1163398165 19:17076047-17076069 ACGGTGAAGGAGAAAGTGGATGG + Intronic
1163453993 19:17395241-17395263 AAGGAGAAACAGGAAGAGGAGGG - Intergenic
1163609316 19:18292824-18292846 AAGCTGAAGCAGGAAGGGGAGGG - Intergenic
1164405097 19:27937238-27937260 AGGAAGAGGCACAAAGTGGAGGG - Intergenic
1164535601 19:29084558-29084580 AAGAAGTAGCTGAAAGAGGAAGG + Intergenic
1164718639 19:30415046-30415068 AAGCAGAAGCAGGAAGAAGAAGG - Intronic
1164776831 19:30859241-30859263 AAGGAGTAGCAGAAGTTGGATGG + Intergenic
1164847289 19:31444228-31444250 AAGAAGAAGAAGAAGGTGGAAGG + Intergenic
1165012585 19:32859622-32859644 AAGCAGAGGCAGAAAGTGCCAGG - Intronic
1165082928 19:33320605-33320627 AAGTAGAAGCCAGATGTGGAAGG + Intergenic
1165931639 19:39362924-39362946 AAGCAGAGCCTGAAAGTGGAGGG - Intronic
1166108860 19:40610869-40610891 ATGGAGAAGCAGAATGAGGAGGG + Intronic
1166140367 19:40802158-40802180 CAGGAGAAGCAGAAGGGGGAGGG + Intronic
1166788076 19:45381360-45381382 ATGTACAAGAAGGAAGTGGAGGG - Intronic
1167608262 19:50493215-50493237 AGGTAGAAGGAGAATGGGGAGGG + Intergenic
1168240720 19:55087567-55087589 AAGCAAAAGAAGAAGGTGGAAGG + Exonic
1168436033 19:56317603-56317625 AAGCAGGATCCGAAAGTGGATGG - Intronic
1202702625 1_KI270712v1_random:176003-176025 AAGAGGAAGCAGCAAGTGCAAGG - Intergenic
926502072 2:13668089-13668111 AAATGGAGGCAGAAATTGGAGGG + Intergenic
926582069 2:14641693-14641715 AAGTATAAGCTGAGAGTTGAAGG - Intronic
926693071 2:15750766-15750788 AAGCAGAAGAACATAGTGGAAGG - Intergenic
926725054 2:15991206-15991228 AAGAAGAAGAAGAAGGTGGCCGG - Intergenic
926947839 2:18207602-18207624 AAGCAGAAAGAGAAAGTGAAAGG - Intronic
927014299 2:18941193-18941215 AAGTAGTAGCAGAATGTGCGAGG + Intergenic
927709338 2:25315141-25315163 AAGCAGAACCAGGAACTGGAAGG - Intronic
928221773 2:29409312-29409334 CAGTAGAAGGAGAAAAAGGAAGG - Intronic
928612685 2:33005905-33005927 GAGTAGCAGCATAAAGTGGTAGG + Intronic
929059170 2:37905652-37905674 GAGTAAAAGAAGAAAGTGTATGG - Intergenic
929350320 2:40943063-40943085 ATGGATAAGAAGAAAGTGGAAGG + Intergenic
929412995 2:41718027-41718049 AAGTAGAGGCAGCAACTGGGTGG + Intergenic
929568601 2:43006038-43006060 AAGGAGAAGCAGAAATGAGAAGG - Intergenic
929627135 2:43420991-43421013 ATCTAGAAGCAGAGATTGGAAGG - Intronic
929895368 2:45955410-45955432 AAGTAGAACCAGACAGTGCAGGG + Intronic
930049829 2:47206373-47206395 AACTTGAAGCAGGAAGTGAATGG - Intergenic
930184351 2:48397019-48397041 AAGTGAAGGCAGAAAGTGGGTGG - Intergenic
930331553 2:49991794-49991816 AAGGAGAAGAACAAAGTTGAAGG + Intronic
930485798 2:52009053-52009075 AAATAGAGCTAGAAAGTGGAAGG - Intergenic
931164662 2:59733563-59733585 CAGTCCCAGCAGAAAGTGGACGG + Intergenic
931809486 2:65840960-65840982 AAGAAGAAGCAGAGAGTAGAGGG - Intergenic
932562588 2:72886706-72886728 AACTTGAAGCTGAAAGTGGATGG + Intergenic
933493009 2:83012342-83012364 AAGGAGAAGAAGAAAGTTGGAGG + Intergenic
934099373 2:88637978-88638000 AATTATAAGCAAAAAGTGCAGGG + Intergenic
934173535 2:89559456-89559478 AAGAGGAAGCAGCAAGTGCAAGG - Intergenic
934283849 2:91633809-91633831 AAGAGGAAGCAGCAAGTGCAAGG - Intergenic
934483124 2:94672498-94672520 AAGTAGAAGTAGAAAGTATTTGG + Intergenic
934631584 2:95930924-95930946 AAGCAGAAGCAGAAGTTAGAAGG - Intronic
934802063 2:97173761-97173783 AAGCAGAAGCAGAAGTTAGAAGG + Intronic
934898306 2:98138096-98138118 ATGTGGAAGAGGAAAGTGGATGG - Intronic
934911385 2:98258295-98258317 AAATAGAAGAACAAAGTTGAAGG - Intronic
935089213 2:99878144-99878166 AACAAGAAGCGGAAAGAGGAAGG + Intronic
935100719 2:99992990-99993012 AAGAAGGAACAGAAAGGGGAGGG - Intronic
935684760 2:105673480-105673502 AAAGTGAAGCGGAAAGTGGATGG - Intergenic
936596819 2:113856012-113856034 ATGAAGATTCAGAAAGTGGAAGG + Intergenic
938038920 2:128059608-128059630 AAGAAGAAGAAGAATGTGGCCGG + Intergenic
938654763 2:133419738-133419760 AAATAGAAGCAGCATGTGGTAGG - Intronic
939335407 2:140820889-140820911 AAGAAGCAACAGAAAGAGGAGGG - Intronic
939582258 2:143964646-143964668 AAGGAGAAGATGGAAGTGGAGGG + Intronic
939698026 2:145352646-145352668 AAGAAGGAGCAGTAAGTGAAAGG - Intergenic
939728702 2:145754874-145754896 AAGAAAAGGCAGAAAATGGATGG - Intergenic
940032152 2:149274868-149274890 AATTAGACGCAGAGAGAGGAAGG + Intergenic
940137219 2:150451603-150451625 AAATAGAAGGAGAAGGAGGAGGG - Intergenic
940164056 2:150748397-150748419 AAGAAAAAGAAGAAAGAGGAAGG - Intergenic
940579185 2:155555100-155555122 AAGTAGACCCAAAAAGAGGATGG + Intergenic
941264266 2:163340418-163340440 AAGTAGAAGCAGCATTTGAAAGG + Intergenic
941760650 2:169238925-169238947 AAGGGGAAAGAGAAAGTGGAGGG - Intronic
942087590 2:172457889-172457911 ATGAAGAAGCAGAAAGCAGATGG + Intronic
942635305 2:177997785-177997807 CAGAAGAAGCAGAAAATGGAGGG - Intronic
942991840 2:182211455-182211477 AAGGAGAAGCACAAAGTTGGAGG - Intronic
943291314 2:186075562-186075584 AAGGAGAAGGAGGAAGAGGAGGG - Intergenic
943617921 2:190115216-190115238 AAGGAGAAGTAGAAAGGAGAGGG + Intronic
945274225 2:207972217-207972239 AAGTAGAACTAGCAAGTGTAAGG + Intronic
945275790 2:207986269-207986291 AAGCCAGAGCAGAAAGTGGATGG + Intronic
946042752 2:216796545-216796567 AAGTAGCAGAAGAAAGACGATGG + Intergenic
946528533 2:220546585-220546607 AAGGAGAAGAAGAAAGAAGAAGG - Intergenic
946734767 2:222743297-222743319 AGGTGGAGGGAGAAAGTGGAAGG - Intergenic
947199603 2:227602953-227602975 AAGGAGAAGCAGAGGGTAGAGGG - Intergenic
947952006 2:234156235-234156257 AAGAAGAAAAAGAAAGAGGAGGG - Intergenic
948433709 2:237937620-237937642 AAATAAAACCAGAAAGAGGAGGG + Intergenic
948738726 2:240028573-240028595 AAGCAGAAGAATAAAGTGGGAGG + Intergenic
1168866239 20:1089506-1089528 AATTAGAAGAAGCTAGTGGAAGG + Intergenic
1169043338 20:2515016-2515038 AAGAAGAAGAAGAAAGAAGAAGG + Intronic
1169047474 20:2545673-2545695 AAGAAGAAGAAGAAAGAAGAAGG + Intronic
1169178628 20:3542567-3542589 AAGGGGAAGGAGAAAGGGGAAGG - Intronic
1169371829 20:5033907-5033929 AAGAAAAATCAGAAAGTGGGTGG - Intergenic
1169979075 20:11363416-11363438 AAGGAGAAGGAGAGAATGGAAGG - Intergenic
1170432344 20:16287948-16287970 TGGTTGAAGCAGAAAGTGGGAGG + Intronic
1170532648 20:17309898-17309920 AAGAAGAAGAAGAAAGGGAAGGG + Intronic
1171393520 20:24816311-24816333 AAGTAGAGGCAGAATGTGGGTGG + Intergenic
1171470566 20:25367603-25367625 TACTAGTAGCAGAAAGTGGAAGG - Intronic
1174024890 20:47565851-47565873 AAGTATAAGAAGTTAGTGGATGG - Intronic
1174317242 20:49713012-49713034 AAGTAGAGGAAGAAAGGGGAGGG + Intronic
1174379393 20:50146922-50146944 AACAAGAATCAGAAAGGGGAAGG - Intronic
1174427094 20:50439493-50439515 AAGTAGACGCAGGAAGGGCATGG - Intergenic
1174577637 20:51547932-51547954 AAGTAGAAGTAGCAAGTCCAGGG - Intronic
1174718235 20:52783482-52783504 ACGGAGAATCAGAAAGTGGCAGG + Intergenic
1175452084 20:59077886-59077908 AAGGAGAAGGAGAAAAAGGAGGG + Intergenic
1177046991 21:16183157-16183179 AAGTGGAAGGTAAAAGTGGAAGG - Intergenic
1177381167 21:20346357-20346379 AATGAAAAGCAGAATGTGGATGG - Intergenic
1177587707 21:23119758-23119780 AAGTGGAAGCAAAAAGGTGAAGG - Intergenic
1177665515 21:24151991-24152013 ACATAGAAACAGAAAGTGGGAGG - Intergenic
1178235677 21:30838385-30838407 AGGTTGAAGCAGAAAGTGTAGGG - Intergenic
1178444713 21:32628212-32628234 AAGTAGAAGGAACAAGTGGGGGG - Intergenic
1178635639 21:34299946-34299968 AAGTAGAAGAAGGCAGTAGAGGG - Intergenic
1179081848 21:38178722-38178744 AAGAAGAAGAAGAAAGAAGAAGG + Intronic
1179582718 21:42353595-42353617 AAGGATAAACAGAAAGAGGAGGG - Intergenic
1181453018 22:23036637-23036659 AAGTAGCTGCTGAAAGAGGAAGG + Intergenic
1182774642 22:32821834-32821856 AATCAGAAGCAGGGAGTGGAAGG - Intronic
1182871436 22:33651038-33651060 AAGGAGTACCAGGAAGTGGAGGG + Intronic
1182977540 22:34637417-34637439 AGGTAGAAGCAGATAGCTGATGG - Intergenic
1183671587 22:39276053-39276075 AGGTAGAAGCAGCAGGTGGCCGG + Intergenic
1183751143 22:39721328-39721350 GAATAGAAGCAGACAGTGAAAGG - Intergenic
1183821935 22:40353303-40353325 AAGAAGAAGAAGAAAGGAGAAGG - Intronic
1183935232 22:41258112-41258134 AAGAGGAGGCAGAGAGTGGAGGG + Intronic
1184185662 22:42863330-42863352 AAGAAGAAGAAGAAAGAAGAAGG + Intronic
1184295925 22:43525541-43525563 AAGGAGGAGGAGAAAGAGGAAGG - Intergenic
1184750196 22:46481417-46481439 CAGTTGAAGCAGAAGCTGGAAGG - Intronic
1184989879 22:48160183-48160205 AAGAAGAAGAAGAAAGAAGAAGG + Intergenic
949316678 3:2764014-2764036 AAGGAGAGGTATAAAGTGGAGGG + Intronic
950352137 3:12365840-12365862 AAGAAGAAGAATAAAGTCGAAGG - Intronic
950482352 3:13252230-13252252 TTGTAGAGACAGAAAGTGGAAGG - Intergenic
950850280 3:16055640-16055662 AAAGAGAAGCAGAAAGTGAAAGG - Intergenic
950975585 3:17239459-17239481 AAGTAGAGGAAGAAATGGGATGG - Intronic
951172615 3:19559425-19559447 AAGTAAATGCAGAAAGTGGTGGG + Intergenic
951272951 3:20649963-20649985 CAGTAGAGGGAGAAAGTGAAGGG - Intergenic
952726824 3:36595308-36595330 AAGGAGAAGGAGAAAGGGAAGGG - Intergenic
952967708 3:38631422-38631444 AAGTGGAAACAGAAAGTGAGAGG + Intronic
953068225 3:39494361-39494383 AAGAAGGAGAAGAAAGTGAAGGG - Intronic
954102468 3:48386106-48386128 AACTACAAGAAGAAAGTGCAGGG - Intronic
954253418 3:49386265-49386287 AAGTATAAGGAGAAAACGGAAGG - Intronic
954699781 3:52445199-52445221 AAGGAGAAGCGGCAGGTGGACGG - Intergenic
956202630 3:66722314-66722336 AAGAAGAAGGAGAAAGAGGGAGG - Intergenic
956225053 3:66947861-66947883 AAAATGAAGCAGAAAGTGGAAGG - Intergenic
956321416 3:68000777-68000799 ATGGAGAGGGAGAAAGTGGATGG + Intergenic
956444302 3:69310448-69310470 AATTATCTGCAGAAAGTGGAAGG + Intronic
956657573 3:71567162-71567184 AAGAAAAATGAGAAAGTGGACGG + Intronic
956833966 3:73080551-73080573 AATGAGAAGTAGAAGGTGGAGGG - Intergenic
956864689 3:73357265-73357287 AAGGAGAAGTAGCAAGTAGAAGG - Intergenic
957002060 3:74898575-74898597 AAATTGAATCAGAAAGTAGATGG - Intergenic
957145986 3:76424463-76424485 ACATAGAAGCAGAGAGTAGAAGG + Intronic
957573289 3:81976712-81976734 AAGAAGGAGGAGAAAGAGGAGGG + Intergenic
957960399 3:87242872-87242894 AAAAAGAAGTACAAAGTGGAAGG - Intronic
959116187 3:102181546-102181568 AAGTAGATCCACGAAGTGGAGGG + Intronic
959243426 3:103830064-103830086 AAGGAGAAGAAGAAGGAGGAAGG - Intergenic
959338786 3:105100933-105100955 AAGTAGAAGAAAAATGTTGATGG - Intergenic
959598680 3:108154929-108154951 AAAAAGAAGAACAAAGTGGAGGG - Intergenic
959768705 3:110066902-110066924 AAGGAGCAGGAGAAAGAGGAAGG - Intergenic
959794473 3:110407726-110407748 AATAAGAAGAAGAAAGTGGGAGG - Intergenic
959849015 3:111066712-111066734 AACTAGAAGGACAAAGGGGAAGG + Intergenic
960431879 3:117579553-117579575 AAGGAGAAGAAGAAAGAGGTCGG + Intergenic
960623710 3:119660344-119660366 AGGTGGAAGCAGGATGTGGAAGG - Exonic
961055349 3:123783668-123783690 AAGTAAAAGGTGAAAGTTGAGGG + Intronic
961085111 3:124060630-124060652 AAGTTGAAGCAGCAAGTCCATGG - Intergenic
962559026 3:136586935-136586957 AAGAAGAGCCAGAAAATGGAGGG + Intronic
963396703 3:144743684-144743706 AAGTAGAAACAAATAATGGAAGG + Intergenic
964055908 3:152457177-152457199 AAGTAGAATCAGAAAATGCTGGG - Intronic
964219708 3:154329189-154329211 AAGTAGAATGAAAAGGTGGAAGG + Intergenic
964560997 3:157996520-157996542 AAGTGGAAGCAGAAGGCAGAAGG + Intergenic
964561097 3:157997421-157997443 AAGTAGAAGCAGAAGGCAGAAGG - Intergenic
964734086 3:159898566-159898588 AAAGAAAAGAAGAAAGTGGAAGG - Intergenic
965193881 3:165568688-165568710 ACTCAGAAACAGAAAGTGGAAGG + Intergenic
965830691 3:172784714-172784736 AAGCAAAACCAGAATGTGGACGG + Exonic
965883558 3:173415739-173415761 TAGTAGAGTCAGAAATTGGATGG + Intronic
966532212 3:180993627-180993649 AAGAGCAAGCAGGAAGTGGAAGG + Intergenic
966765052 3:183453677-183453699 AAGGAGGAGGAGAGAGTGGAGGG + Intergenic
966895108 3:184439084-184439106 AAGGAGAAGGAGAAAGGGGGAGG + Intronic
967516335 3:190373151-190373173 AAGTATAAGGAGAAAGGGAAGGG - Intronic
968036887 3:195555162-195555184 AAGTGGAAGTAGAAAGGCGAAGG - Intergenic
968376544 4:47593-47615 AAGAAGAAGAAGAAAGAAGAAGG + Intergenic
969827395 4:9768272-9768294 AAGAGGAAGCAGCAAGTGCAAGG - Intergenic
970166861 4:13247755-13247777 AAGTAGAAGGAGAAAGAAGATGG - Intergenic
970203771 4:13635192-13635214 TAGGAAAAGCAGAAATTGGAGGG + Intergenic
970737548 4:19192298-19192320 AAGGATAAAAAGAAAGTGGAAGG - Intergenic
970831653 4:20346872-20346894 AAGCAGCAGAAGAACGTGGAAGG - Intronic
970864938 4:20747560-20747582 GTGTAGAAGCAGTTAGTGGAGGG - Intronic
970916184 4:21338002-21338024 ATGGTGGAGCAGAAAGTGGAAGG - Intronic
971055921 4:22912372-22912394 AAGGACAGACAGAAAGTGGAAGG - Intergenic
971090622 4:23340535-23340557 AAGGAGAAGAAGAAAGTTGGAGG + Intergenic
971156313 4:24087107-24087129 AAGTAGCAGAAGAAAGTTTATGG + Intergenic
971233493 4:24819755-24819777 AAGCAGCAGCACAAAGGGGAAGG + Intronic
971259494 4:25043402-25043424 AGGTAGAAGCTGAAAGAAGATGG + Intergenic
971413887 4:26404825-26404847 AAGTAGACACAGGAAGTGGGAGG - Intronic
971686428 4:29775279-29775301 AAGTAGAAACAATAAGTGGTGGG - Intergenic
971732580 4:30404844-30404866 AAGCAGAGGTATAAAGTGGAGGG - Intergenic
972025892 4:34376939-34376961 AAGGAGAAGCAGAAAGTGTGAGG + Intergenic
972162988 4:36247630-36247652 AAGTAGAAGGAGGAAAAGGAGGG - Intergenic
974366515 4:60956731-60956753 AAATAGAAGCATAAAGTGAGGGG + Intergenic
975391468 4:73822890-73822912 AAGAAGAGGGAGAAAGGGGAGGG + Intergenic
977152476 4:93530109-93530131 AATTGGAAGTAGAAAGTGAAAGG - Intronic
977664943 4:99635450-99635472 AAGTGGAAGATGAAAGTAGAGGG + Intergenic
977846375 4:101772807-101772829 AAGAAGAAAAAAAAAGTGGAGGG + Intronic
978852298 4:113353749-113353771 AAGCAGAAACAAAAAGAGGAAGG + Exonic
979106686 4:116698045-116698067 AAGTAAAAGCACAAAGTGACAGG - Intergenic
979288183 4:118950407-118950429 AAGCAGAAGCAGAGAGCAGAAGG + Intronic
979405014 4:120299168-120299190 AAGAAAAAGGAGAAAGAGGAAGG - Intergenic
979757092 4:124354480-124354502 AAGAAGAAGAAGAAAGTTGGAGG - Intergenic
979975611 4:127192591-127192613 AAGTAGCACCAAAAAGAGGAAGG - Intergenic
980044794 4:127975337-127975359 TCATAGAAGCAGAAAGTAGAAGG - Intronic
980347134 4:131635747-131635769 AAGTAGTACCTGAAAATGGAAGG + Intergenic
980433722 4:132740688-132740710 AAGATGAAGCAGAAAGTGCTGGG + Intergenic
980445563 4:132902470-132902492 TAGTAGAAGCACAAAAGGGATGG - Intergenic
981640070 4:146931975-146931997 AAGAAAAAGCAGAAAGAAGAAGG - Intronic
981721653 4:147808122-147808144 AAGTAGATGCACACAGTGGCAGG - Intronic
982224768 4:153155402-153155424 AAGAATATGCAGAAATTGGAGGG + Intronic
982255452 4:153447057-153447079 AAGGAGAAGCAGGAGGTTGATGG - Intergenic
982267179 4:153548697-153548719 AGGTAAAGGCAGAAAGTGGAGGG + Intronic
982465159 4:155721460-155721482 CAGAGGAAGCAGAAAGTGGAAGG - Intronic
983034546 4:162847491-162847513 TAGTAGAAGGATAAAGTGCATGG + Intergenic
983426715 4:167593458-167593480 AAGAAGAAGAAGAAAGAAGAAGG + Intergenic
984189552 4:176589019-176589041 TAGTAGAAGGAGAAAGAGGAAGG + Intergenic
984535534 4:180970070-180970092 AAGTAGCAGCAAAAAGAAGAGGG - Intergenic
984617537 4:181915644-181915666 GAGGAGAAGCAGAGAGGGGAGGG + Intergenic
984632567 4:182076187-182076209 AAGAAGAAGGAGAAAGAGGCTGG - Intergenic
984765352 4:183396582-183396604 AAGTGGAAACAGAAACAGGAAGG - Intergenic
984850693 4:184149992-184150014 AACTAGAAGGATAAGGTGGAGGG + Intronic
984951644 4:185012267-185012289 AAAGAAAAGCAGCAAGTGGAGGG - Intergenic
985168343 4:187121810-187121832 AAGTAGAAGGAGGAAGAGGAGGG + Intergenic
985262983 4:188132004-188132026 ACTCAGAAGCAGAAAGTAGAAGG - Intergenic
986149298 5:5112237-5112259 AAATAGAAGCAGACAGTGAATGG + Intergenic
986221734 5:5774775-5774797 AAGTAGGAGGAGAAGGAGGAGGG - Intergenic
986266633 5:6196703-6196725 ATGTAGAGGCAGCAAGAGGATGG + Intergenic
986525460 5:8669471-8669493 TAGTAGAACCAGATAGTTGAAGG - Intergenic
986658387 5:10037510-10037532 AAACAGAGGCAGAAATTGGAGGG + Intergenic
986989107 5:13531201-13531223 AAGAAGAAGTAGGAAGGGGAGGG - Intergenic
987032852 5:13991503-13991525 AAGGAGAAGGAGGAAGAGGAGGG + Intergenic
987098194 5:14568350-14568372 AAGTGGAACCAGAAAGTAAATGG + Intergenic
987149095 5:15020849-15020871 AAGGAGAAGCAGAGAGAGGAGGG + Intergenic
987382526 5:17298926-17298948 AAGTGGAAAGAGAAATTGGAAGG + Intergenic
987510838 5:18836312-18836334 GAGGAGGAGGAGAAAGTGGAGGG - Intergenic
988031622 5:25770670-25770692 TAGAAGAAACAGAAAGTTGAGGG + Intergenic
988106075 5:26750156-26750178 AAGGAGAAGAAAAAAGAGGAGGG - Intergenic
988276655 5:29089664-29089686 AAGAGGAAGTAGAAAGAGGAGGG - Intergenic
989483726 5:41963725-41963747 AAGGAGGAGCAGGAAGAGGAAGG + Intergenic
989628572 5:43457519-43457541 GAGTAGAAGACTAAAGTGGAAGG + Intronic
989654620 5:43733135-43733157 AAGGAGAAGGAAAAAGTGGTGGG - Intergenic
990123430 5:52484364-52484386 AAGAAGAAGGAGAATGAGGAGGG + Intergenic
990262286 5:54036416-54036438 ATGTAGAAGTAGAAATTGGATGG - Intronic
990474409 5:56147872-56147894 AAGAAGAAGAAGAAAGGAGAAGG - Intronic
991203507 5:64021916-64021938 AAGTAGAAAGAGAAAGTGAAGGG - Intergenic
992097393 5:73375665-73375687 AAGAACAAGCAGGAAGAGGAAGG + Intergenic
992121799 5:73601343-73601365 AAGGAGAAGAACAAAGTTGAAGG - Intergenic
992203909 5:74411330-74411352 GAAAAGAAACAGAAAGTGGAAGG - Intergenic
992477544 5:77118358-77118380 AGGCCGAAGGAGAAAGTGGAAGG + Intergenic
992971390 5:82062609-82062631 AAGAAGAAGCAGGATGTGAATGG + Intronic
993312372 5:86350727-86350749 AAATTTAATCAGAAAGTGGAGGG - Intergenic
994141759 5:96348914-96348936 AATTATGAGCAGAAAGTGCAAGG + Intergenic
994145624 5:96391877-96391899 AATCAGAAGCAGAAACTGGCAGG - Exonic
994302719 5:98165073-98165095 AAGCAGAAGCAGAAGGGGAAGGG - Intergenic
995541990 5:113194680-113194702 AAGAAAAAGAAGAAAGGGGAAGG + Intronic
996246274 5:121267370-121267392 AAGTAGAAGCAGATTTGGGAGGG - Intergenic
996262621 5:121492119-121492141 ACACAGAAGCAGAAAGTGAAAGG - Intergenic
996501395 5:124220560-124220582 AAGAAAAAGAAGAAAGAGGAGGG - Intergenic
996676903 5:126186674-126186696 AACTCATAGCAGAAAGTGGAAGG + Intergenic
997506534 5:134421993-134422015 AAGGAGAAGGAGGAAGAGGAAGG - Intergenic
998006414 5:138659852-138659874 AAGGAGAAGGAGAAAGGAGATGG - Intronic
998662625 5:144256968-144256990 TAGTAAAATCAGAATGTGGAAGG + Intronic
998821819 5:146064135-146064157 GAGGAGAAGGAGAAAGAGGAGGG + Intronic
998876101 5:146600985-146601007 AATGAGAATCAGAAAGTAGATGG - Intronic
999272477 5:150304657-150304679 AAAGAGAAGCAGCAAGGGGATGG + Intronic
999376614 5:151091170-151091192 AAGAAGAAGCAGAAAGGAGCTGG - Intronic
999440278 5:151595472-151595494 AAGGAGGAGCAGAAGGTGGAAGG + Intergenic
999444673 5:151629846-151629868 AAGAAGAAGAAGAAAGAAGAAGG + Intergenic
1000024422 5:157346491-157346513 AAACAGAGGCAGAGAGTGGAAGG + Intronic
1000823800 5:166018607-166018629 AAGTAAAATAAGTAAGTGGATGG - Intergenic
1001088828 5:168722001-168722023 ATAAAGAAGCAGAAAGTTGAAGG + Intronic
1001361804 5:171093330-171093352 AAGTAGTAGTAAACAGTGGAGGG - Intronic
1001426536 5:171626156-171626178 AAGAAGAAGAAGAAAGGTGAAGG - Intergenic
1001681293 5:173558974-173558996 AAATATAAGGAGAAAGTGGGGGG - Intergenic
1001692716 5:173644710-173644732 CAGTGGAACCAGAAAATGGAGGG - Intergenic
1002045873 5:176541624-176541646 AAGCAGAGGCAGGAAGAGGAGGG + Intergenic
1002863011 6:1096649-1096671 AAGAAGAAGAAGAAAATTGAGGG - Intergenic
1003138625 6:3453811-3453833 AAGTAGAAGCAGAAAGTGGAAGG - Intronic
1003509929 6:6771287-6771309 AAGAAGAAGGAGAAGGAGGAAGG + Intergenic
1003509940 6:6771330-6771352 AAGAAGAAGGAGAAGGAGGAAGG + Intergenic
1003509951 6:6771373-6771395 AAGAAGAAGGAGAAGGAGGAAGG + Intergenic
1003670642 6:8154650-8154672 CAGAAGAGGCAGAGAGTGGAAGG + Intergenic
1004368474 6:15031865-15031887 GAGAAGAAGAAGAAAGAGGAGGG + Intergenic
1004462714 6:15853428-15853450 AAGGAGAAGCAGAAGGGGAAGGG - Intergenic
1006000183 6:30958525-30958547 AAGGAGAAGGAAAAACTGGAAGG - Intergenic
1006104988 6:31711061-31711083 AAATAGAAGCACAAAGTGGGAGG + Intronic
1006238006 6:32652694-32652716 AAGTGGAAGCATAAAGTGGAGGG + Intergenic
1006975221 6:38094168-38094190 AAGTAGCAGCAGAGAGCTGAGGG + Intronic
1007367714 6:41406635-41406657 AAGCAGAAGCAGAAGGAGGTTGG + Intergenic
1007619254 6:43201981-43202003 AGGTAGAAGAAGGAGGTGGAAGG + Intronic
1007668443 6:43531195-43531217 AAGTCGAAGCTAAAAGTGGTGGG - Intronic
1007871263 6:45041682-45041704 AAGAAGAAAAAGAAGGTGGAAGG - Intronic
1009456117 6:63858466-63858488 AAGTAGAGGGAAAAAGTGAAAGG + Intronic
1009683610 6:66928440-66928462 CAGTAGTAGCACAAAATGGATGG + Intergenic
1010216282 6:73404750-73404772 AAGTAGAAGCAGATAGTTGGAGG + Exonic
1010303500 6:74288807-74288829 AAGAAAAAGCAGAAACTGAATGG - Intergenic
1011194632 6:84768449-84768471 AGCTAGAAGCAGAAATGGGACGG + Intergenic
1011362325 6:86540642-86540664 GAGTGGAAACAGAAAATGGAAGG + Intergenic
1011401727 6:86969948-86969970 AAGTAGAACCAAGAAATGGAGGG + Intronic
1011407045 6:87026489-87026511 AAGAAGAAGAAGAAAGTGAGGGG + Intergenic
1011568061 6:88701143-88701165 AAGAAGAAGAAGAAGGTAGATGG + Intronic
1012494379 6:99818516-99818538 AAGAAGAAGAAGAAGGGGGAGGG - Intergenic
1012693548 6:102348861-102348883 AAGAGGAAGCAAAAAGTGAAAGG + Intergenic
1012735622 6:102937866-102937888 AAGAAGAAGAACAAAGTTGAAGG - Intergenic
1012887678 6:104863921-104863943 AAGTAGAGGCAGGAAATGCAGGG + Intergenic
1013490869 6:110645540-110645562 AAGTAGAAGTAGAAAGATAAAGG + Intronic
1014344903 6:120255973-120255995 AAGTAGAAACAGAAAATGACTGG + Intergenic
1014457239 6:121650066-121650088 AATTGAAAGCAGAAAGTAGATGG + Intergenic
1014615478 6:123592842-123592864 AGATAGAAGCAGACAGTGAATGG - Intronic
1014689583 6:124546694-124546716 AAGTCTTAGGAGAAAGTGGAAGG + Intronic
1015015424 6:128407043-128407065 AGTTGGAAGCAGAAATTGGAGGG - Intronic
1016429782 6:143970985-143971007 AGGGAGAGGCAGAGAGTGGAGGG - Intronic
1017624366 6:156333147-156333169 AAATAGAAGAACAAAGTTGAAGG - Intergenic
1018365935 6:163119920-163119942 ATGTGGAAGCAGAAAATGAATGG - Intronic
1018593468 6:165453377-165453399 AAGTAGAGACAGAAAGTAGCAGG + Intronic
1018657927 6:166057750-166057772 AAGTGGAAGGAGAAATTGAAAGG - Intergenic
1018950797 6:168377627-168377649 AAGTAGAAGAGGAAATCGGAAGG - Intergenic
1019504099 7:1382008-1382030 AAGCAGAAGCTGGAAGTGGGGGG - Intergenic
1019875236 7:3804505-3804527 AAAAAGAAGCAAAAAGTGGGAGG - Intronic
1019969144 7:4526137-4526159 AAGAGGAAGAAGAAAGGGGAAGG + Intergenic
1020119759 7:5496395-5496417 AAGAGGAAGAAGAATGTGGAAGG - Intronic
1020593560 7:10174082-10174104 AAAAAGAAGAAGAAAGTTGAAGG - Intergenic
1021305261 7:19023931-19023953 AAGTAAAAGCAGAACGTGGATGG + Intronic
1021951914 7:25783280-25783302 TAGGAGAAGCAGCAACTGGAAGG - Intergenic
1022890050 7:34687934-34687956 ATTTAAAAGCAGAAACTGGAAGG + Intronic
1022959708 7:35414832-35414854 CAGTTGAATGAGAAAGTGGATGG + Intergenic
1023047089 7:36219590-36219612 AAGAAGAAGGAGGAAGAGGAAGG + Intronic
1023047096 7:36219639-36219661 AAGAAGAAGGAGGAAGAGGAAGG + Intronic
1023214496 7:37847531-37847553 AAGAAGAAGGAGAAAGAAGAAGG + Intronic
1023344599 7:39258716-39258738 AAGAAGAAGAAGAAGGTGGTAGG + Intronic
1023842249 7:44104251-44104273 AAGGAGGAGCCGAGAGTGGACGG - Intergenic
1023950758 7:44842635-44842657 AATTTGAAGTAGAAAATGGAAGG - Intronic
1024129522 7:46336409-46336431 AAGTAGAGGTAGAAAGTTCAGGG + Intergenic
1024355920 7:48413225-48413247 AGACAGAAGCAGAAAGAGGAGGG - Intronic
1025040326 7:55637759-55637781 AACTAGATCTAGAAAGTGGAAGG + Intergenic
1025246696 7:57323003-57323025 AAGTAGACGCAGGAAGGGCATGG + Intergenic
1026284147 7:68948375-68948397 AAGGAGGAGGAGAAAGAGGAGGG - Intergenic
1027631614 7:80613063-80613085 AAGTAGTAGTAGAGAGAGGAGGG + Intronic
1027748310 7:82107427-82107449 AGGGAGAAGCAGAGAGAGGAAGG - Intronic
1027821540 7:83051756-83051778 AAGAAGAAGAAGAAAGTTGAAGG + Intronic
1027843092 7:83339092-83339114 AAGTAGAAAGAGATACTGGATGG - Intergenic
1027882216 7:83855132-83855154 AAGAAGAAGGAGAAAGAGGCAGG + Intergenic
1028099592 7:86803616-86803638 AAGTGGCAGCAAAAAGTAGAAGG - Intronic
1028123377 7:87083100-87083122 AAGTAGAAGCACCCAATGGAAGG + Intergenic
1028167600 7:87556492-87556514 ATGTAGAAGCAGAGAAGGGAAGG + Intronic
1028256013 7:88598482-88598504 AAGAAGAACAAGAAAGCGGAGGG + Intergenic
1028832178 7:95340313-95340335 AAGTGGGTGCAGAAATTGGATGG + Intergenic
1029520253 7:101056309-101056331 AAGGAGAAGAAGAAAGTCGCAGG - Intronic
1029595758 7:101536895-101536917 ATGTAAAGGCAGGAAGTGGAGGG + Intronic
1029597631 7:101546103-101546125 AAGGAGGTGCAGAGAGTGGACGG + Intronic
1029835143 7:103301514-103301536 AAGGAGAAACAGAAAAAGGAAGG + Intronic
1029956686 7:104647772-104647794 AGGAAGAAGGAGAAAGAGGAAGG + Intronic
1029966397 7:104745245-104745267 AGGAAGAAGGAGAAAGAGGAAGG - Intronic
1030190535 7:106806112-106806134 AAATGGAAGGAGAAAGAGGAGGG + Intergenic
1030484327 7:110147868-110147890 GTGTAGAAACAGAAAGTGAATGG + Intergenic
1031649840 7:124275281-124275303 AAGGAGAAACAGGAAGTTGATGG + Intergenic
1031901609 7:127417495-127417517 AAGTAGAAATAGAAAATGAAAGG - Intronic
1032204115 7:129846828-129846850 TAGTAGAAGGAGAAAGGGGATGG - Intronic
1032399384 7:131613206-131613228 AAGTATAAGCATAAAGTCAATGG + Intergenic
1032553857 7:132811515-132811537 AAGTGGAGGCAGAAATTGAAAGG - Intronic
1032952375 7:136929621-136929643 AAGTAGAAGGACTTAGTGGATGG + Intronic
1033189001 7:139259303-139259325 AAGCGGAAGCGGAAAGAGGAAGG + Exonic
1033592055 7:142817373-142817395 AAGGAGAATTACAAAGTGGATGG - Intergenic
1033647120 7:143313996-143314018 TCATAGAAGCAGAAAGTAGAGGG - Intergenic
1033804392 7:144937599-144937621 AAGGGGAAGCAGAAAGGGGAAGG - Intergenic
1034944920 7:155255652-155255674 AAGAAGAAGGGGAAAGGGGAAGG + Intergenic
1034975127 7:155444176-155444198 TCATAGAAGCAGAAAGTAGAAGG + Intergenic
1035168665 7:157006000-157006022 ACTTAGAAGCAGAATGGGGAGGG + Intronic
1035189994 7:157158411-157158433 AAGTAGATGCACAGAGTGGCAGG + Intronic
1035579988 8:733403-733425 TGGTAGAAGCAGAAACTTGATGG + Intronic
1035766260 8:2108132-2108154 AATTAGAATCAGAAAGAAGATGG - Intronic
1036044095 8:5120310-5120332 AATTCCAAACAGAAAGTGGAGGG + Intergenic
1036521363 8:9494493-9494515 CAGTAAGAGCAGAAAGTAGATGG - Intergenic
1036527756 8:9551081-9551103 AAGTAAAAGGAGATAGTGGGTGG + Intergenic
1037218216 8:16484057-16484079 AAGGAGAAGAAGAAAGGGTAGGG + Intronic
1037570295 8:20152216-20152238 AAATATAAGAGGAAAGTGGAGGG + Intronic
1037809037 8:22075310-22075332 AAGAAGAAGAAGAAGGGGGAGGG - Intronic
1038138243 8:24814068-24814090 AAGTAGAAGGAGAGACAGGAAGG - Intergenic
1039301418 8:36213198-36213220 AATGAGATGCCGAAAGTGGAAGG - Intergenic
1039411374 8:37357955-37357977 AAGTAGGAGAAGAAATGGGAAGG - Intergenic
1039556936 8:38483267-38483289 AAGCAGAAACAGGAAGAGGAAGG - Intergenic
1039564173 8:38538078-38538100 AACTACAAGCAGAAAGGGGGAGG - Intergenic
1039674505 8:39646885-39646907 AAGTAGAAGGAGAATGAAGAGGG + Intronic
1040452323 8:47560486-47560508 ACTTATAAGCAGAAACTGGAAGG - Intronic
1041321185 8:56614131-56614153 AAAAAGAAGAAGAAAGTGGAAGG - Intergenic
1042021321 8:64373299-64373321 AATTTCAAGCAGAAAGTAGAAGG + Intergenic
1042942189 8:74118755-74118777 AAGGAGAAGGAGAAGGAGGAGGG - Intergenic
1043385588 8:79744634-79744656 AAGTAAAAGGAGAAGGGGGATGG + Intergenic
1043503952 8:80884610-80884632 AGGAAGAAGAAGAAAGAGGAAGG + Intergenic
1043543032 8:81283762-81283784 AAGTAGACTCAGAAAGGAGAAGG + Intronic
1043796672 8:84550234-84550256 AAGGAAAAGGAGAAAGTGGAGGG - Intronic
1044275461 8:90294392-90294414 AGGTAGAAGAAAAAAGAGGAAGG - Intergenic
1044289520 8:90451483-90451505 AAGGAAAAGAAAAAAGTGGAAGG - Intergenic
1044538889 8:93388222-93388244 AAGTGGAAGAAGAAAATGGAGGG + Intergenic
1045803265 8:106126573-106126595 AAGTAGAAACAAAATTTGGAGGG + Intergenic
1046015600 8:108601126-108601148 AAGAAGAAGGAGAAGGAGGAGGG + Intergenic
1046230123 8:111345290-111345312 AAAAAGAAGAAGAAAGAGGAAGG + Intergenic
1046461178 8:114538333-114538355 CAGTAGATGCAGGAAGAGGAGGG + Intergenic
1046489555 8:114932303-114932325 ATGTTGAAACAGAAAGAGGAGGG - Intergenic
1046538280 8:115544853-115544875 AAGGAGGAGAAGAAGGTGGAGGG + Intronic
1046739588 8:117814025-117814047 AAGAAGAAGAAGAAAGAAGAAGG + Intronic
1047345132 8:124020424-124020446 AAGATGAAGCAGACAGTGGCAGG + Intronic
1048250966 8:132866611-132866633 AAGGAGAAGGAGAAAGGGTAGGG + Intergenic
1048781180 8:138003677-138003699 GTGGAGCAGCAGAAAGTGGAAGG - Intergenic
1050063869 9:1738239-1738261 AAGTAGAAGCTGAAAGTGCAAGG - Intergenic
1050212475 9:3277435-3277457 AAGCCTATGCAGAAAGTGGATGG - Exonic
1050266062 9:3891080-3891102 AAGAAGAAGAAGAAAGTAGGAGG + Intronic
1050386450 9:5096201-5096223 AGGTAGAAGAAATAAGTGGAGGG - Intronic
1050488878 9:6166053-6166075 AAGGAGATGCAGAAAGTAAAAGG + Intergenic
1050942172 9:11473187-11473209 AAGAAGAAGAAGAAAGTAGAAGG + Intergenic
1051035566 9:12740946-12740968 AAATATAAGCTGCAAGTGGAAGG - Intergenic
1051202306 9:14641005-14641027 AAATAAAAGCACCAAGTGGATGG + Intronic
1051567152 9:18513336-18513358 ACATAGAAGCAGACAGTAGAAGG - Intronic
1051848912 9:21486320-21486342 AAGAAGAAGCAGGAGGTGGTAGG - Intergenic
1051938544 9:22474144-22474166 AAGTTGATGTAGAAAGTAGATGG - Intergenic
1052138701 9:24949456-24949478 CAGTACATGCAGAAAGTGGGAGG + Intergenic
1052201282 9:25784261-25784283 AAGAAAATGCAGAAAGTGGAGGG - Intergenic
1052216813 9:25976050-25976072 AAGGGGAAGCAGAAGGTGAAGGG - Intergenic
1052328823 9:27246074-27246096 AGGTATGAGAAGAAAGTGGAGGG + Intergenic
1052597649 9:30580834-30580856 AAGAGGAACAAGAAAGTGGAGGG + Intergenic
1052656661 9:31371844-31371866 TAGTGGAAGAAGAATGTGGATGG + Intergenic
1053419349 9:37967501-37967523 TAGTAGAAGCACAGAGGGGAAGG + Intronic
1053465679 9:38306708-38306730 AATTACAAGCAAAAAGAGGAAGG - Intergenic
1053485724 9:38454622-38454644 AAGTGGAAGCAGAATGGGGCTGG - Intergenic
1053504048 9:38625560-38625582 AAGAAGAGGCAGAAAGAGGATGG - Intergenic
1053674661 9:40411903-40411925 AAGTAGAAGTAGAAAGTATTTGG - Intergenic
1053683989 9:40504906-40504928 AAGTAGATACAGAGAGTGGGGGG + Intergenic
1053924453 9:43038258-43038280 AAGTAGAAGTAGAAAGTATTTGG - Intergenic
1054385764 9:64551970-64551992 AAGTAGAAGTAGAAAGTATTTGG - Intergenic
1054395104 9:64644878-64644900 AAGTAGATACAGAGAGTGGGGGG + Intergenic
1054429751 9:65150078-65150100 AAGTAGATACAGAGAGTGGGGGG + Intergenic
1054509960 9:65964391-65964413 AAGTAGAAGTAGAAAGTATTTGG + Intergenic
1054964102 9:71002555-71002577 AAGTAGACGTATATAGTGGAAGG - Intronic
1055211368 9:73798110-73798132 AAGAAGAAGTAGAAATTGAAAGG - Intergenic
1055391550 9:75827255-75827277 AAGCAAAAGCAGAATGTGGATGG + Intergenic
1056121988 9:83497688-83497710 AAAGAGAAGCAGAGAGTGGAAGG - Intronic
1056402109 9:86238148-86238170 AAGTACAAGAAGAAAATAGAGGG + Intronic
1056583406 9:87912223-87912245 AAATAGAAGAATAAAGTGGGAGG + Intergenic
1056583930 9:87915854-87915876 AAATAGAAGAATAAAGTGGGAGG - Intergenic
1056612939 9:88137066-88137088 AAATAGAAGAATAAAGTGGGAGG + Intergenic
1056613439 9:88140560-88140582 AAATAGAAGAATAAAGTGGGAGG + Intergenic
1056684497 9:88748390-88748412 TCTTAGAAGCAGAAAGTAGAAGG - Intergenic
1057159686 9:92880302-92880324 AAATAGAAGAATAAAGTGGGAGG + Intergenic
1057767992 9:97940365-97940387 ATCTAGAAGCAGAGTGTGGAGGG + Intronic
1057932115 9:99203485-99203507 AAGTAGAAGCAACGAGTGAAAGG + Intergenic
1058373863 9:104301123-104301145 AATTAGAAGCTGAAAGTCAATGG + Intergenic
1058593457 9:106589503-106589525 AAGAAGAAGAAGAATGAGGAGGG + Intergenic
1058779337 9:108317669-108317691 AAATAGAAGCAGAAAAAGAATGG + Intergenic
1058830914 9:108815532-108815554 AAGTAAAAGCAGCACGTTGAAGG - Intergenic
1059195207 9:112364978-112365000 ACGTAGAAGCAGCAAATAGAAGG - Intergenic
1059614832 9:115938218-115938240 AAATAGAAGAAGAAAGATGATGG + Intergenic
1059692101 9:116695595-116695617 CAGGAGAAGGAGGAAGTGGAGGG - Intronic
1060146134 9:121253929-121253951 AAGGAGAAGAAGAAAGTGAAGGG - Intronic
1060303047 9:122387176-122387198 ATGTCCAAGCAGAAATTGGAAGG + Intronic
1060474690 9:123977884-123977906 AGATGGAAGCAGAAATTGGAGGG - Intergenic
1060476672 9:123992239-123992261 AGATGGAAGCAGAAATTGGAGGG + Intergenic
1060709678 9:125846641-125846663 ATGTAGAAGGAGAAAGCTGATGG - Intronic
1061587619 9:131578954-131578976 AAGGGGAAGCGGAAAGTGAAAGG + Exonic
1062000433 9:134213214-134213236 TAGGAAAACCAGAAAGTGGAAGG + Intergenic
1062092580 9:134686221-134686243 AAGGAGAAGGAGAAGGAGGAAGG - Intronic
1062638406 9:137503569-137503591 AAGGAGAAGGAGAAGGAGGAGGG + Intronic
1203572686 Un_KI270744v1:146580-146602 AAGAAGAAGAAGAAAGAAGAAGG - Intergenic
1185499165 X:584408-584430 AAGTAGAAGCAGGAAGAGTGGGG + Intergenic
1186030322 X:5361731-5361753 GAGTAGAGGCATAAAGTGAAAGG - Intergenic
1186072904 X:5842106-5842128 AAGCAGAAGCAGAAACAGGAGGG + Intronic
1186443703 X:9607739-9607761 AAGTAGAACATGAAAGAGGATGG + Intronic
1186459946 X:9740034-9740056 CAGGAGAAGGAGAAAGTGGGAGG + Intronic
1186647586 X:11523766-11523788 AAGTAGAACCAGCAAGTGGAGGG + Intronic
1186942784 X:14529224-14529246 AATTTGAAGCAGAAAAGGGAAGG - Intergenic
1187012933 X:15298412-15298434 AAGTAGAAGCAGGAGATGGGAGG + Intronic
1187254748 X:17632145-17632167 AAAGAGAAGGAGAATGTGGAAGG + Intronic
1187416138 X:19094900-19094922 AAAAAGAAGGAGAAAGTGGACGG - Intronic
1187417902 X:19109045-19109067 AAGAAGAAGAAGAAAGAAGAAGG + Intronic
1187710074 X:22044413-22044435 AAATAGTAGCAGTAAGTGGCCGG + Intronic
1188314824 X:28660065-28660087 AAGCAGAAGCAGAGTGAGGATGG + Intronic
1188602215 X:31981591-31981613 AAGAAGAACCAGAAAGACGAAGG + Intronic
1188650326 X:32624212-32624234 AAGTAAAAGCAAAAGGTGAATGG + Intronic
1189420464 X:40852735-40852757 AAGTAGAAGCTGAAAGAGGAAGG + Intergenic
1189709704 X:43796555-43796577 AAGGAGGAGGAGAAAGAGGAGGG + Intronic
1189731889 X:44029551-44029573 AAGTCGAAGCAGAGAGGCGACGG + Intergenic
1190215892 X:48479119-48479141 AAATAGCAACAGAAAGTGGGAGG + Intronic
1190311857 X:49122564-49122586 AAGAAGAGGAAGAAGGTGGAAGG - Intronic
1191845520 X:65544650-65544672 AAGTAGAAGAACAAAATGAAAGG + Intergenic
1192272041 X:69589907-69589929 AAGAAGAAGAAGAAAGAAGAAGG - Intergenic
1192481486 X:71490054-71490076 AAGTAGGAGGGGAAAGTGGAGGG - Intronic
1192967084 X:76189273-76189295 TTATAGAAGCAGAGAGTGGAAGG - Intergenic
1193851804 X:86546312-86546334 AAGAAGAAGAAGAAAGAGGTAGG - Intronic
1194184227 X:90752762-90752784 AAGTAGTAGTAGAAAGTGGAGGG + Intergenic
1194448556 X:94015185-94015207 AAGAAGCTGCAGAAAGTAGAAGG - Intergenic
1194739324 X:97553687-97553709 AAGAAGAAGAAGAAAATGGCTGG + Intronic
1195152410 X:102085394-102085416 ATGTAGCATCAGAAAGTAGAAGG - Intergenic
1195789650 X:108569526-108569548 AAGGAAAAGGAGAAAGGGGAGGG - Intronic
1196065446 X:111459144-111459166 GAGGAGAAGGAGAAAGAGGAGGG - Intergenic
1196101722 X:111853858-111853880 CAGGAGAAGCATAAAGAGGAAGG + Exonic
1196134649 X:112195108-112195130 AGGTTGAGGCAGAATGTGGATGG + Intergenic
1196586612 X:117436473-117436495 TAGGAGAAGCAAAGAGTGGAGGG + Intergenic
1196714493 X:118798600-118798622 AAACAGAAGCTGGAAGTGGAGGG - Intergenic
1196895840 X:120334721-120334743 CAGTAGGAGCAGAATGGGGAAGG - Intergenic
1197382710 X:125765371-125765393 AAGTGGAAGAAAAAAGGGGAAGG - Intergenic
1197693384 X:129525448-129525470 AAGTAGTAGCAGATAGAGCAAGG - Intergenic
1198370688 X:135985940-135985962 AAGGCGAGGCAGAAAATGGAAGG - Intronic
1198623296 X:138538163-138538185 AAGTGGTATCAGAAAGGGGAGGG - Intergenic
1198697805 X:139362362-139362384 AAGCAGAAGCAAACAGTAGATGG - Intergenic
1198741130 X:139844311-139844333 AAGGAGTAGCAGAGAGTGGAGGG + Intronic
1200118686 X:153780566-153780588 TAGAAGAAGCAGGAAGTGGCTGG + Intronic
1200255876 X:154582590-154582612 AAGGAGAAAGAGAAAGTGAAGGG - Intergenic
1200261893 X:154621813-154621835 AAGGAGAAAGAGAAAGTGAAGGG + Intergenic
1200530816 Y:4334685-4334707 AAATACTAGTAGAAAGTGGAGGG + Intergenic
1200757015 Y:6999607-6999629 AAGTAGAATATGAAAGAGGATGG + Intronic
1201286675 Y:12384799-12384821 AAGTAGAAGCAGTTCATGGATGG + Intergenic
1201461675 Y:14232565-14232587 AAGAAGAAGCAGAAGAAGGAAGG - Intergenic
1201730081 Y:17193246-17193268 AAGAAGAAGCAGAGTGTGAAGGG + Intergenic
1202021599 Y:20470254-20470276 AGCTAGAAGCAGAAAGGGGAAGG - Intergenic