ID: 1003138930

View in Genome Browser
Species Human (GRCh38)
Location 6:3455986-3456008
Sequence CCTTGTCCGGAGGGGATGGC AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 127
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 114}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1003138916_1003138930 20 Left 1003138916 6:3455943-3455965 CCGTAGTCCCATGCGCGGCAGTC 0: 1
1: 0
2: 0
3: 1
4: 31
Right 1003138930 6:3455986-3456008 CCTTGTCCGGAGGGGATGGCAGG 0: 1
1: 0
2: 1
3: 11
4: 114
1003138918_1003138930 12 Left 1003138918 6:3455951-3455973 CCATGCGCGGCAGTCACAGTTGG 0: 1
1: 0
2: 0
3: 2
4: 52
Right 1003138930 6:3455986-3456008 CCTTGTCCGGAGGGGATGGCAGG 0: 1
1: 0
2: 1
3: 11
4: 114
1003138917_1003138930 13 Left 1003138917 6:3455950-3455972 CCCATGCGCGGCAGTCACAGTTG 0: 1
1: 0
2: 0
3: 2
4: 34
Right 1003138930 6:3455986-3456008 CCTTGTCCGGAGGGGATGGCAGG 0: 1
1: 0
2: 1
3: 11
4: 114

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1003138930 Original CRISPR CCTTGTCCGGAGGGGATGGC AGG Exonic
901171520 1:7261711-7261733 CTCTGTCCTGAGGTGATGGCTGG - Intronic
902976836 1:20094621-20094643 CCTGGTACGGATGGGATTGCTGG - Intergenic
903189650 1:21649630-21649652 CCTTGCCCTGAGAGGATGGTTGG + Intronic
903731771 1:25501757-25501779 CCCTGTCTGGAGGGCTTGGCTGG - Intergenic
903767982 1:25747026-25747048 CCTTGCAGGGAGGGGATGGATGG - Intronic
904336713 1:29802591-29802613 CCTGGGCCTGGGGGGATGGCAGG + Intergenic
905107357 1:35572402-35572424 GCTTGTCAGGAGGGGAGGGTTGG + Intergenic
907046510 1:51303186-51303208 CATAGTCCTGAGGGGATGGGAGG + Exonic
907320089 1:53596556-53596578 CCCTCTGCGAAGGGGATGGCAGG + Intronic
910146404 1:84085686-84085708 CCTTGTCAGGCAGGGAGGGCTGG + Intronic
912050874 1:105526421-105526443 CCTTGAACGAAGGGGATGCCAGG - Intergenic
916841923 1:168609768-168609790 CCCTGTTCAGAGGGGAGGGCTGG + Intergenic
917218375 1:172701672-172701694 ACTTGTATGAAGGGGATGGCAGG + Intergenic
920084665 1:203406552-203406574 CCTTGTCCCGAGGGGTTGACAGG - Intergenic
920824898 1:209416067-209416089 ACTTGTCAGGTGGGGATGGCAGG - Intergenic
922947149 1:229526388-229526410 CTTTGTCCTGAGTGGAAGGCAGG - Intronic
924615123 1:245606161-245606183 CCTGGGCCAGAGGGGGTGGCAGG - Intronic
1069717488 10:70530263-70530285 GCATGTCCTGAGTGGATGGCGGG + Intronic
1072093399 10:92151915-92151937 CCTTGTTAGGAGGTGATGTCAGG - Intronic
1077244278 11:1528604-1528626 CCTTGTCCTGCGGGGGTGGGGGG - Intergenic
1084774302 11:71365168-71365190 CCTTTTCCAGAGAGGAAGGCTGG - Intergenic
1084973279 11:72782704-72782726 CCCTGGCTGGAAGGGATGGCAGG - Intronic
1089782780 11:120885248-120885270 CCGTGTGCGGAGTGCATGGCAGG - Intronic
1090438046 11:126703105-126703127 CCTGGTCAGGTGGGGGTGGCTGG + Intronic
1090485115 11:127106177-127106199 CCATGACATGAGGGGATGGCTGG - Intergenic
1091095818 11:132821285-132821307 CCTTGTGCCTAGGGGATGTCTGG - Intronic
1098111010 12:67121855-67121877 CCTTGTCTGGATGTGATGCCTGG + Intergenic
1101372988 12:104146931-104146953 CCTGGTCCACAGGGGATAGCTGG - Intergenic
1102497589 12:113330190-113330212 CCATGTGCTGAGGGGATAGCAGG - Intronic
1108698997 13:52927709-52927731 GCTTGTGCTGAGAGGATGGCAGG + Intergenic
1113694157 13:112332037-112332059 CTTTGTCCTGAGCGGCTGGCTGG + Intergenic
1117768528 14:59108101-59108123 CCTGCTCCGGTGGAGATGGCAGG - Intergenic
1128269455 15:66295203-66295225 CCTTGTCGGAGGGGGATGGGAGG + Intronic
1128757640 15:70194332-70194354 CCTTTTGCAGAGGGGCTGGCAGG + Intergenic
1129246849 15:74284369-74284391 CCTTCTCCCTAAGGGATGGCAGG + Intronic
1132038973 15:98508778-98508800 CTTTGTCAGGAGGGGATGCTAGG - Intronic
1135087776 16:19488553-19488575 CCTTGTTGGGAGGGGCTTGCTGG - Intronic
1137686504 16:50390553-50390575 CCTGAGCAGGAGGGGATGGCAGG - Intergenic
1142333839 16:89473798-89473820 CCTTGCCCGGAGTGCAAGGCGGG + Intronic
1142696862 17:1638714-1638736 CCTTGTGGGGTGGGGAGGGCTGG - Intronic
1143779349 17:9221257-9221279 CCTTGTCTGGGGAGGATGGGAGG + Intronic
1145059594 17:19724420-19724442 CCAAGTTGGGAGGGGATGGCGGG - Intergenic
1145869951 17:28265827-28265849 ACTGGTCCGCAGGGGAGGGCCGG - Intergenic
1147696927 17:42362299-42362321 TCTTTTCCTGAGGGGATGGCAGG - Intronic
1150625488 17:66838472-66838494 CCTTGTGGGGAGGAGAAGGCTGG + Intronic
1152811512 17:82384873-82384895 CCCTGGCCGGGGAGGATGGCTGG + Intergenic
1157544562 18:48538997-48539019 ACGTGGCCGGAGGGGAGGGCGGG + Intergenic
1158581889 18:58691108-58691130 TCTTCTCTGGAGGAGATGGCGGG - Intronic
1158649777 18:59274251-59274273 CCTTGTCCTGCGGGGAGGGCGGG + Intergenic
1160219705 18:76965770-76965792 CCTGTTCCGGTGGAGATGGCAGG + Intronic
1161508598 19:4657852-4657874 CCTTGTCCGGAGGGGCTTGCAGG - Exonic
927189736 2:20509407-20509429 CCTGGTGCGGAGGGCATGGTGGG - Intergenic
932594553 2:73086065-73086087 CCTTGCAGGGAGGGGAAGGCTGG - Intronic
932708214 2:74043325-74043347 CCATGGCCTGTGGGGATGGCAGG + Intronic
934014654 2:87866836-87866858 ACATGGCAGGAGGGGATGGCGGG - Intergenic
934950938 2:98575003-98575025 CCTTATCCCCAGGGGATGCCTGG - Intronic
937316827 2:120937035-120937057 CCTTGGAAGGAGGGGATGGAGGG - Intronic
942043964 2:172088315-172088337 TCTTTTCCGGACGGGATGGATGG - Exonic
946156791 2:217812281-217812303 CCATGTCCGGAGTGGCTGGCAGG + Intronic
946870107 2:224077185-224077207 CCCTGTGCAGAGGGAATGGCAGG - Intergenic
946873982 2:224110211-224110233 CCTACTCCAGAGGGGATGGATGG + Intergenic
947399366 2:229715476-229715498 CCTACTTCGGAGGGGATGGGGGG + Intergenic
948685744 2:239668578-239668600 GCTGGTCCAGAGGGGTTGGCTGG + Intergenic
948787384 2:240359570-240359592 CCAGGCCCGGAGGGGAGGGCAGG - Intergenic
1171135652 20:22692274-22692296 CCTCTCCCGGTGGGGATGGCTGG + Intergenic
1173210505 20:41028523-41028545 CCTGGTCCGGAGGCGGTGCCCGG + Intergenic
1174044595 20:47724510-47724532 CCTTCTAGGGAGCGGATGGCTGG - Intronic
1175402480 20:58708392-58708414 CCTGGGCAGGAGGGGCTGGCAGG + Intronic
1175664210 20:60844319-60844341 CCTTGTGCAGAGAAGATGGCTGG + Intergenic
1175864267 20:62166227-62166249 CCTCGTCCGGGAGGGAAGGCGGG + Intronic
1175929101 20:62485197-62485219 CCTCGTCAGGAGGGCAGGGCTGG + Intergenic
1176000334 20:62828752-62828774 CCTTGTCCCCAGGGCATGCCGGG + Exonic
1179571858 21:42283205-42283227 CCTTCTGAGGGGGGGATGGCGGG + Intronic
1180713818 22:17858169-17858191 CCTTGGCGGGAGGGGGTGGTAGG - Intronic
1180742162 22:18061300-18061322 CCTTGCCCAGAGGAGAGGGCAGG + Intergenic
1181601137 22:23952481-23952503 CTTTTTTCGGAGGGGAAGGCTGG - Intergenic
1181607372 22:23988845-23988867 CTTTTTTCGGAGGGGAAGGCTGG + Intergenic
1181833628 22:25583560-25583582 CCATGTCCAGAGGGGGTGACAGG - Intronic
1182353029 22:29709477-29709499 CCTTGTCAGGAGGCCAGGGCAGG + Intergenic
1184692586 22:46123952-46123974 CCTTGTCTGGAGGTGATGGGCGG + Intergenic
1185070933 22:48655210-48655232 CCGTGTCTGAAGGGGCTGGCAGG + Intronic
950105864 3:10388027-10388049 CCTGGCCCGGAGGGGAAGGAGGG + Intronic
953932628 3:47013314-47013336 CCTCTTCTGGAGGGGATGGGTGG - Intergenic
955965049 3:64380507-64380529 TCTTGGCAGGAGGGCATGGCTGG + Intronic
956153558 3:66269066-66269088 ACTTGTCAGGAGCAGATGGCTGG - Intronic
961213700 3:125143857-125143879 CCTAGACCGCAGGGCATGGCAGG - Intronic
961647057 3:128398205-128398227 CCTTGGCCCTAGGGGAAGGCTGG + Intronic
968856238 4:3125890-3125912 CTTTGTGAGTAGGGGATGGCAGG + Intronic
970268684 4:14318967-14318989 CCTTTTCAGGAGGGCAGGGCAGG + Intergenic
980381585 4:132026827-132026849 TCTTGTGCTGAGGTGATGGCAGG + Intergenic
980954589 4:139415374-139415396 CCTTGTCCGGAAGGAAGGGAGGG - Intronic
981331366 4:143513866-143513888 CCGAGTCCGGCGGGGATGGACGG - Exonic
984847856 4:184122805-184122827 CCATGGCCTGTGGGGATGGCTGG + Intronic
989736153 5:44709598-44709620 TCTTTTCTGGAGGGGATGGCAGG + Intergenic
990376217 5:55173345-55173367 CCTCGGCCGGAGGCGGTGGCGGG - Intergenic
995915156 5:117236631-117236653 GCCTGTCCGGAGGGGGTGGGAGG - Intergenic
997619135 5:135273327-135273349 CCTTGTCCAGCGGGGAGGGCTGG + Intronic
998255974 5:140588457-140588479 CTTGGGCCGGAGTGGATGGCAGG + Intronic
998703372 5:144731293-144731315 CTTTGTCCGGAGTGGAGTGCTGG + Intergenic
999883896 5:155898707-155898729 CTGTATCCTGAGGGGATGGCTGG - Intronic
1001781578 5:174373579-174373601 TCTTGTCCGGTGGAGAAGGCAGG + Intergenic
1003138930 6:3455986-3456008 CCTTGTCCGGAGGGGATGGCAGG + Exonic
1003146219 6:3512710-3512732 CCTTGGCTGGAGGGGAAGGCAGG + Intergenic
1006337365 6:33427752-33427774 CCTGCTCAGGAGGGGATGGTGGG + Intronic
1012519707 6:100106341-100106363 CTTTGTCCTGAGGGGATTGGGGG + Intergenic
1018618123 6:165707247-165707269 CCTGGTCCCCAGGGGATGGGTGG + Intronic
1020208909 7:6143048-6143070 GCTTCTCCAGTGGGGATGGCCGG + Intronic
1026490420 7:70858305-70858327 AGTTGTCATGAGGGGATGGCTGG - Intergenic
1026986616 7:74559131-74559153 CCTTGTCCAGGGGGGAGGGCAGG - Intronic
1027995402 7:85419425-85419447 CCTTCTCCGGGGGGGAGGGGGGG - Intergenic
1037886084 8:22597229-22597251 CCTTGTCAGGAGTGCATGGACGG + Intronic
1039167170 8:34696222-34696244 CCATTTCCGGACGGGATCGCAGG + Intergenic
1045252257 8:100491872-100491894 CCTTGTCTGGAAGGAATGCCTGG - Intergenic
1046509607 8:115185261-115185283 CCTTGCCCCAAGGGTATGGCAGG + Intergenic
1047848015 8:128826340-128826362 CCCCGTCCGGAGGAGATGGGGGG - Intergenic
1049204996 8:141359519-141359541 CCTTGTGTGGTGGGGGTGGCAGG - Intronic
1049685894 8:143939201-143939223 CCGTGTTGGGTGGGGATGGCTGG + Intronic
1050552094 9:6757713-6757735 CCTTGCCCGGAAGCGCTGGCTGG - Intronic
1058413828 9:104764327-104764349 CCCTGGCCGGAGGGGAGGGGAGG + Intronic
1062326438 9:136014711-136014733 CCCTGGCTGGAGGGTATGGCTGG + Intronic
1062380340 9:136284013-136284035 CTTTGCCCTCAGGGGATGGCGGG - Intronic
1186206459 X:7205530-7205552 CTGTGTCTGGAGGGGTTGGCTGG + Intergenic
1189354165 X:40298834-40298856 GCTTGTCCGGAGGGCCTGGCCGG - Intergenic
1190893854 X:54596939-54596961 CCTTTGCCAGAGGGGAGGGCAGG - Intergenic
1199129824 X:144171675-144171697 ACATGGCAGGAGGGGATGGCGGG + Intergenic
1199616274 X:149658626-149658648 CCAGGTCCTCAGGGGATGGCAGG + Intergenic
1199626367 X:149744622-149744644 CCAGGTCCTCAGGGGATGGCAGG - Intergenic