ID: 1003139000

View in Genome Browser
Species Human (GRCh38)
Location 6:3456244-3456266
Sequence GGATCCAGGTGAGCAGCACG AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 190
Summary {0: 1, 1: 0, 2: 4, 3: 18, 4: 167}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1003138992_1003139000 25 Left 1003138992 6:3456196-3456218 CCAGGAGGAACGAGTCCGAGAAC 0: 1
1: 0
2: 0
3: 4
4: 45
Right 1003139000 6:3456244-3456266 GGATCCAGGTGAGCAGCACGAGG 0: 1
1: 0
2: 4
3: 18
4: 167
1003138997_1003139000 -7 Left 1003138997 6:3456228-3456250 CCGATGAACAGCGCCGGGATCCA 0: 1
1: 0
2: 0
3: 2
4: 37
Right 1003139000 6:3456244-3456266 GGATCCAGGTGAGCAGCACGAGG 0: 1
1: 0
2: 4
3: 18
4: 167
1003138994_1003139000 10 Left 1003138994 6:3456211-3456233 CCGAGAACTGGCTGAAGCCGATG 0: 1
1: 0
2: 0
3: 6
4: 160
Right 1003139000 6:3456244-3456266 GGATCCAGGTGAGCAGCACGAGG 0: 1
1: 0
2: 4
3: 18
4: 167

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1003139000 Original CRISPR GGATCCAGGTGAGCAGCACG AGG Exonic
900254814 1:1692615-1692637 GGATCCAGGTGGGCTTCACGGGG + Exonic
900263565 1:1745890-1745912 GGATCCAGGTGGGCTTCACGGGG + Exonic
900420922 1:2555601-2555623 GGTTCCTGGTGTGCAGCAGGCGG + Intergenic
902207422 1:14879179-14879201 GGAACCAGGTGACCAGCACAAGG - Intronic
903419860 1:23210865-23210887 GGACCCAGGTGTGCAGCATCTGG - Intergenic
903865185 1:26392677-26392699 GGAACATGGTGAGGAGCACGGGG + Intergenic
905028311 1:34865846-34865868 GGATCCAGGTGAGGGGCGCAGGG + Exonic
905546245 1:38802423-38802445 GGATCCAGGCCAGTAGCATGAGG + Intergenic
906614818 1:47226704-47226726 GAGTCCAGCTGAGCAGAACGAGG - Intronic
907697938 1:56752943-56752965 AGAGCCAGGGGAGCAGCACTGGG - Intronic
915278786 1:154808224-154808246 AGATCCTGGTGAGCAGCAGCTGG - Intronic
915593998 1:156886145-156886167 AGATCCAGGTGGGAAGCACGAGG - Intergenic
917535047 1:175868364-175868386 GGTTCCAGTGGAGCAGCACAGGG - Intergenic
921391636 1:214621246-214621268 GGAGCCAGATGAGAAGCATGGGG - Intronic
922889327 1:229048030-229048052 GGACACAGGTGATCAGCACTGGG + Intergenic
924074579 1:240320064-240320086 GCATCCAGGTTAGCAGCAACTGG + Intronic
924645370 1:245872538-245872560 GGATCCAACTGAGGAGCACTTGG + Intronic
1062904311 10:1169700-1169722 GGATGCAGCTGAGCAGCCCTCGG + Intergenic
1063005304 10:1964738-1964760 GGAACCTGGCGAGCAGGACGTGG + Intergenic
1071390543 10:85170997-85171019 GGATCCTGGAGAGCAGCAGGAGG + Intergenic
1072609871 10:97010978-97011000 GGCTACAGGTGAGCAGCCCCTGG - Exonic
1073009094 10:100346546-100346568 GGTCCCGGGTGAGCAGCGCGTGG + Intergenic
1073242205 10:102066113-102066135 GGCTCCAGATGAGTAGAACGTGG - Exonic
1074801451 10:117005007-117005029 GGAGCAAGGTAGGCAGCACGCGG - Exonic
1075623248 10:123943484-123943506 GGGTTTGGGTGAGCAGCACGAGG + Intergenic
1076810477 10:132884076-132884098 GGACCCAGCTGAGCTGCACTGGG - Intronic
1077370172 11:2178041-2178063 GGAGCCAGGTGAGCAGTGAGGGG + Intergenic
1077370236 11:2178287-2178309 GGAGCCAGGTGAGCAGTGAGGGG - Intergenic
1077454158 11:2667914-2667936 GGACCCATGTGTGCAGCACCCGG + Intronic
1080960321 11:37150170-37150192 GGAGCCAGGAGAACAGCAGGAGG + Intergenic
1084625639 11:70304298-70304320 GGACCCAGGTGAACAGCAGAAGG - Intronic
1085053726 11:73392483-73392505 GGGTCCAGGTGGGAAGGACGGGG + Intronic
1089556205 11:119317121-119317143 AGAGCCAAGTGAGCAGCTCGAGG + Intronic
1090944761 11:131419989-131420011 GGAGTCAGGTGATCAGCACCAGG + Intronic
1091221366 11:133931606-133931628 GGATCCAGGTGCCCAGCTCATGG + Intronic
1093604520 12:21073877-21073899 GGGACCAGGTGAGCGGCAGGGGG + Intronic
1102741973 12:115216181-115216203 GGATGGAGCTGAGCAGCAGGTGG - Intergenic
1103410981 12:120711007-120711029 GGATCCAGTTCAGCTGAACGGGG - Intronic
1103914198 12:124368185-124368207 GGATGCTGGTGACCAGCACGTGG + Intronic
1104357268 12:128098930-128098952 GGGCTCATGTGAGCAGCACGTGG - Intergenic
1104956354 12:132468162-132468184 AGATGCAGGTGAGCAGCCTGCGG + Intergenic
1106612792 13:31299705-31299727 GGATCCAGGTGACCACCTCAAGG + Intronic
1108934783 13:55870699-55870721 TGAGCCAGGTGTGCAGCAAGTGG + Intergenic
1110302028 13:73939906-73939928 TGATCCTGGTGAGGAGCAAGGGG - Intronic
1111808305 13:93065827-93065849 GGATCCAGCAGAGAAGCACGAGG + Intergenic
1113577378 13:111403945-111403967 GGATACAGGTGACCAGCCCCGGG + Intergenic
1113584790 13:111457898-111457920 GAATGCAGGGGAGCAGCACCAGG + Intergenic
1113922211 13:113919514-113919536 GGATCCGGGCGGGCAGCACAGGG - Intergenic
1117414261 14:55479251-55479273 GGATGCAGGATAGCAGCAAGGGG - Intergenic
1119427750 14:74546837-74546859 GGAACCAGGAGTGCAGCAAGTGG + Intronic
1121032941 14:90674917-90674939 GGAGGCAGGTGACCACCACGAGG + Intronic
1121998238 14:98623517-98623539 GGGACCAGGTGAGCAGCCTGTGG + Intergenic
1122232951 14:100316191-100316213 GGATCCAGGTGAGAACCCTGAGG + Intergenic
1122479074 14:102034181-102034203 ACATCCAGGTGAGAATCACGGGG + Exonic
1122607169 14:102954520-102954542 GGGGCCAGGTGAGCAGCATCTGG + Intronic
1122831163 14:104396681-104396703 GGCTCCAGGTGAGCTGCACCTGG + Intergenic
1122831245 14:104397258-104397280 GACTCCAGGTGAGCTGCACCTGG - Intergenic
1125448596 15:39784240-39784262 GGAACCAGGTCAGGAGCACTTGG + Intergenic
1127551717 15:60045049-60045071 GGATGCAGCTGAGGAGCACCGGG - Intronic
1128088925 15:64905818-64905840 GGATCCAGGTGAGAGGGACTAGG - Intronic
1128518365 15:68358443-68358465 AGATCCAGGTGAGCATCTCTTGG - Exonic
1129164246 15:73767321-73767343 GACTCCAGGAGGGCAGCACGGGG + Intergenic
1129265197 15:74389579-74389601 GGAACCAGTTGTGCAGCATGTGG + Intergenic
1131029914 15:89177820-89177842 GGATCCAAGGGAGCAGAACTAGG + Intronic
1132556807 16:576179-576201 GGAGCCAGGACAGCAGCATGAGG - Exonic
1132745256 16:1433716-1433738 GATTCCAGGTGAGCAGCAAGGGG + Intergenic
1132858340 16:2057594-2057616 GGATACAGGAGAGCAGGAGGGGG - Intronic
1133257355 16:4525441-4525463 GGATGCAGGTGCCCAGCACAGGG + Intronic
1134130133 16:11643638-11643660 GAATTGAGGTGACCAGCACGAGG - Intergenic
1136118492 16:28112087-28112109 GGTTCCAGGTGTGCAGCCAGCGG - Intronic
1136640157 16:31557365-31557387 CGATCCAGGTGAGCAGGAGTGGG - Intergenic
1138551524 16:57751449-57751471 GGATCCAGGTGGGCCGCCCATGG - Intronic
1141175159 16:81713788-81713810 GAATCCTGGTGAGCAGCCCACGG - Intergenic
1141427618 16:83953910-83953932 GGCTCCAGGTGTGCGGCACTGGG + Intronic
1141442160 16:84036618-84036640 GTTTCCAGTTGAGCAGGACGTGG - Intronic
1142312031 16:89319771-89319793 GGCACCAGGCGTGCAGCACGCGG + Intronic
1144455539 17:15415365-15415387 AAAACAAGGTGAGCAGCACGTGG - Intergenic
1144663846 17:17088935-17088957 AGATGCAGGTCAGCAGCACAGGG + Intronic
1145121793 17:20266967-20266989 CGACCCAGGTCAGCAGCACTGGG + Intronic
1148495938 17:48053677-48053699 GGCTCCAGGGGAGCAGCAGTGGG + Intronic
1148759988 17:49994659-49994681 GGACCCAGGTGAGGGCCACGGGG - Exonic
1150136215 17:62696750-62696772 GGATCCAGGTGGCCAGAGCGGGG - Intergenic
1151721493 17:75859044-75859066 TGAACCAGGTGAGCAGCAGGAGG + Intergenic
1152022205 17:77785954-77785976 GGGTGCAGGTGGGCAGCACAGGG + Intergenic
1152738649 17:82009404-82009426 GGGTGCAGGTGAGGAGCCCGGGG + Intronic
1156181636 18:34612044-34612066 GGCTGCAGTTGAGCAGCAAGTGG - Intronic
1158546598 18:58403135-58403157 GGAGGCACATGAGCAGCACGGGG - Intergenic
1160812312 19:1018104-1018126 GGACCCAGGTGACCACCAAGTGG - Intronic
1162447801 19:10734499-10734521 GACTCCAGGTGAGCACCACCAGG - Intronic
1162794377 19:13078932-13078954 GGAGCCAGGTGGGCAGCCCAGGG - Intronic
1163294859 19:16405446-16405468 GGATCCAGATGGTCAGCCCGAGG + Intronic
1163388525 19:17015354-17015376 GGACCCTGGTGACCATCACGGGG + Intronic
1166944256 19:46387446-46387468 AGATTCAGGTGAGCAGCGCGGGG + Exonic
1167380570 19:49135831-49135853 GGATCCAGGTGGGCACCAGAAGG - Exonic
1168404374 19:56103124-56103146 GAACCCAGGTGAGCAGCCAGAGG - Exonic
925180823 2:1815883-1815905 GCATCCAGGTGAGAGGCACACGG + Intronic
926160215 2:10482526-10482548 TGATACAGGTGAGCAGCCAGAGG + Intergenic
926314350 2:11698217-11698239 GGGCCCAGATGAGCCGCACGTGG + Intronic
927561396 2:24076674-24076696 GGACCCAGGTGAGTAGCGGGAGG + Intronic
927812623 2:26188386-26188408 GGATCCAGGGGAGATGCATGTGG + Exonic
929994439 2:46816602-46816624 GGCCCCAGGACAGCAGCACGAGG - Intergenic
936059226 2:109283551-109283573 AGATCCTGGTGAGCAGGATGGGG + Intronic
936252202 2:110875614-110875636 GGATCGAGGTGAGCAGCAAGGGG - Intronic
939533404 2:143393591-143393613 GGATACAGGTGCGCAGCACCAGG - Intronic
948205512 2:236160956-236160978 GGTTCCAGGGCAGCAGCACCAGG + Intergenic
1172435950 20:34929016-34929038 GGACCCAGCTGAGCAGTACCTGG + Intronic
1174303956 20:49601987-49602009 GGTTCCAGATCAGCAGCACAAGG - Intergenic
1174507126 20:51023807-51023829 GGCTCCAGGGCAGCAGCGCGTGG - Intergenic
1175987718 20:62772203-62772225 GGGTCCAGGCGAGCCGCACACGG - Intergenic
1176227718 20:64011496-64011518 GGATCCAGGTGGGCCGCAGGCGG + Exonic
1178362533 21:31961066-31961088 GGCTACAGAGGAGCAGCACGAGG - Intronic
1179500288 21:41804519-41804541 TCGTCCAGGTGAGCAGCATGGGG - Exonic
1182289374 22:29266642-29266664 GGATGCAAGAGAACAGCACGGGG - Intronic
1185075008 22:48678305-48678327 GCATCCAGGTGTGGAGCCCGGGG - Intronic
949129976 3:487968-487990 AGATCCACGTGATCAGCACTAGG - Intergenic
949602426 3:5614754-5614776 GGATCCAGATGAGCACCAACAGG - Intergenic
950679196 3:14573418-14573440 GGATCCTGGTGTGCAGGAAGAGG + Intergenic
954752742 3:52822918-52822940 GGACTCAGGAGAGCAGCACCAGG - Intronic
956605739 3:71071266-71071288 GCATCCAGGTGAGCAACCCTGGG + Intronic
964413407 3:156422917-156422939 GAATCCAGGTGAGCATTTCGAGG + Intronic
968488602 4:877389-877411 GGATCCTGGTCAGCAGCAGGAGG - Intronic
968488613 4:877448-877470 GGATCCTGGTCAGCAGCAGGAGG - Intronic
968735014 4:2290738-2290760 GGAGCCAGGTGAGCACCCCAAGG - Intronic
968976370 4:3824288-3824310 GGAGGCAGGTGAGCAGCATGCGG - Intergenic
969074913 4:4570319-4570341 GGATGCAGGTGACCAGGAGGAGG + Intergenic
969626780 4:8309622-8309644 GGCTCCAGGTGACCAGCATCAGG + Intergenic
969688667 4:8691133-8691155 GCATCCATGTGAAGAGCACGAGG + Intergenic
969688673 4:8691182-8691204 GCATCCATGTGAAGAGCACGAGG + Intergenic
972169921 4:36333607-36333629 GGATCCAGCAGAGCAGCAGTAGG + Intronic
979224894 4:118273574-118273596 GGATCCAGCTAAGCCACACGTGG - Intergenic
979440035 4:120740681-120740703 GGAGCCAGGTGAGCAGGAATAGG - Intronic
985120354 4:186634546-186634568 GGAGCTAGGTGAGCATTACGTGG + Intronic
985632074 5:1018940-1018962 GCATCTAGGGGAGCAGCAGGTGG + Intronic
985728220 5:1526677-1526699 GGATCCAGGGCAGCAGCTCAAGG + Intergenic
985785278 5:1890025-1890047 GCATCCAGGTGAGGAGGAGGAGG - Intergenic
986258347 5:6120858-6120880 TGAGCCAGGTCAGCAGCTCGTGG - Intergenic
989331994 5:40270475-40270497 GGCTCCAGCTGAGCAGGATGGGG + Intergenic
995023460 5:107392574-107392596 GGATCCAGCTAAGCTGCACCTGG + Intronic
997429673 5:133829014-133829036 GGTCCCAGATGAGAAGCACGTGG - Intergenic
998530872 5:142883294-142883316 GGATACATGTGAGCAGCATTTGG + Intronic
1002679747 5:180951882-180951904 AGATCCAGGTGAGCAGCCCGAGG + Intergenic
1002936859 6:1681501-1681523 GGCTCCAGGTGAGGAGGACCAGG + Intronic
1003139000 6:3456244-3456266 GGATCCAGGTGAGCAGCACGAGG + Exonic
1003940995 6:11026431-11026453 AGATACAGGTGGGCAGCATGTGG + Intronic
1014767416 6:125422589-125422611 GCTTCCAGGTGAGAAGTACGGGG + Intergenic
1015692775 6:135944098-135944120 GAATCCTGGTGAGCAGCACCAGG + Intronic
1016828093 6:148406579-148406601 GGATCCAGGTAAGCAAGACAGGG + Intronic
1017607212 6:156147076-156147098 GGCAGCAGGTGAGCAGCACCAGG + Intergenic
1018438274 6:163782903-163782925 GGAACCAGGGCAGCAGCAGGTGG + Intergenic
1019703065 7:2483603-2483625 GGAGCCAGCTGAGCAGGATGGGG + Intergenic
1020269022 7:6581188-6581210 GGATCAAAGTGAGCAAAACGGGG + Intronic
1021342988 7:19488172-19488194 GGATCCAGGCCAGTAGCATGAGG - Intergenic
1023366602 7:39470722-39470744 TGATCCAGGTGAGAGGCAGGTGG - Intronic
1029170695 7:98627433-98627455 GGGGCCAACTGAGCAGCACGAGG + Intronic
1032037134 7:128529828-128529850 GGAGACAGGAGAGCAGCTCGGGG - Intergenic
1033587294 7:142783499-142783521 GCATCCATGTGGGCAGCAGGGGG - Intergenic
1035223755 7:157422371-157422393 GGATCCAGGTGAGCAACTCGGGG - Intergenic
1035279671 7:157769812-157769834 GAATCCAGGTGAGGAGCGCCTGG - Intronic
1035625388 8:1067187-1067209 GGATCCAGGCCAGCAGCACGAGG - Intergenic
1039740240 8:40376289-40376311 GGACCCAGGTAAAAAGCACGGGG - Intergenic
1041431202 8:57782595-57782617 GTCTCCAGGTGAGCAGCTCCTGG - Intergenic
1042145879 8:65730032-65730054 GGAACCAGGTGCACAGCAGGAGG + Intronic
1044186316 8:89255775-89255797 TAATCCAGGTGAACAGCAGGAGG - Intergenic
1045673863 8:104588225-104588247 GGTTCCCCGGGAGCAGCACGCGG - Intronic
1047190327 8:122673655-122673677 GGTTCCAGTTGAGCAGCTCTTGG - Intergenic
1048220245 8:132534353-132534375 GGAGCCAGGTGAGCATGAGGAGG - Intergenic
1056788825 9:89612130-89612152 GCATCCAGGTGAGAAGCAGGTGG - Intergenic
1057442459 9:95091951-95091973 GGATCTATGTGAGAACCACGGGG - Intergenic
1062248406 9:135582093-135582115 GGTTCCTGATGATCAGCACGTGG - Intergenic
1062368937 9:136226703-136226725 CCTTCCAGGTGAGCATCACGCGG - Intronic
1062520389 9:136955254-136955276 GGCTTCAGGTGAGAAGCAGGAGG - Intronic
1062547761 9:137071253-137071275 GGAGCCAGGAGAGCAGCTGGAGG - Intergenic
1187441838 X:19327856-19327878 GGCTCCAGGGAAGCAGCAGGAGG - Intergenic
1187477038 X:19620552-19620574 GGACTCAGCTGAGCAGCCCGAGG - Intronic
1187521001 X:20013993-20014015 GGATCCAGGAGACCAGCCTGTGG - Intronic
1187576033 X:20556512-20556534 GCATCCAGATGTGCAGCACCAGG + Intergenic
1189607732 X:42697816-42697838 GGAACAAGGTGAGCAGCTGGAGG - Intergenic
1192911083 X:75605015-75605037 GGACACAGGTGAGTAGCAAGTGG + Intergenic
1195638964 X:107153176-107153198 GGATGCAGATGAGGAGCATGTGG - Exonic
1198421442 X:136473387-136473409 GAAGCCTGGTGAGCAGGACGTGG - Intergenic
1199954967 X:152735246-152735268 GCATCCAGGTGAGAAGCCTGAGG + Exonic
1200235044 X:154464067-154464089 GGGTGCAGGTGAGCAGCTTGGGG + Exonic
1200992246 Y:9356393-9356415 GGAGCCAGGTGGGAGGCACGTGG - Intergenic
1200994895 Y:9376671-9376693 GGAGCCAGGTGGGAGGCACGTGG - Intronic
1200997560 Y:9397017-9397039 GGAGCCAGGTGGGAGGCACGTGG - Intergenic
1201000072 Y:9465553-9465575 GGAGCCAGGTGGGAGGCACGTGG - Intergenic
1201002733 Y:9485863-9485885 GGAGCCAGGTGGGAGGCACGTGG - Intronic
1201005388 Y:9506147-9506169 GGAGCCAGGTGGGAGGCACGTGG - Intergenic
1201008051 Y:9526476-9526498 GGAGCCAGGTGGGAGGCACGTGG - Intergenic
1201010665 Y:9546666-9546688 GGAGCCAGGTGGGAGGCACGTGG - Intergenic