ID: 1003141722

View in Genome Browser
Species Human (GRCh38)
Location 6:3477478-3477500
Sequence CCATTGATGGAACGGGGCTC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1003141714_1003141722 1 Left 1003141714 6:3477454-3477476 CCAGTTTTGCGGTAGACAATTTT No data
Right 1003141722 6:3477478-3477500 CCATTGATGGAACGGGGCTCGGG No data
1003141711_1003141722 19 Left 1003141711 6:3477436-3477458 CCTCTGTAGCACCGTGGACCAGT No data
Right 1003141722 6:3477478-3477500 CCATTGATGGAACGGGGCTCGGG No data
1003141713_1003141722 8 Left 1003141713 6:3477447-3477469 CCGTGGACCAGTTTTGCGGTAGA No data
Right 1003141722 6:3477478-3477500 CCATTGATGGAACGGGGCTCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1003141722 Original CRISPR CCATTGATGGAACGGGGCTC GGG Intergenic
No off target data available for this crispr