ID: 1003144870

View in Genome Browser
Species Human (GRCh38)
Location 6:3501540-3501562
Sequence TGGGACTCCTTCACATAAAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1003144870_1003144877 16 Left 1003144870 6:3501540-3501562 CCTGTTTATGTGAAGGAGTCCCA No data
Right 1003144877 6:3501579-3501601 AATCTGTTTTTAAAAAGGAAGGG No data
1003144870_1003144878 17 Left 1003144870 6:3501540-3501562 CCTGTTTATGTGAAGGAGTCCCA No data
Right 1003144878 6:3501580-3501602 ATCTGTTTTTAAAAAGGAAGGGG No data
1003144870_1003144876 15 Left 1003144870 6:3501540-3501562 CCTGTTTATGTGAAGGAGTCCCA No data
Right 1003144876 6:3501578-3501600 AAATCTGTTTTTAAAAAGGAAGG No data
1003144870_1003144880 27 Left 1003144870 6:3501540-3501562 CCTGTTTATGTGAAGGAGTCCCA No data
Right 1003144880 6:3501590-3501612 AAAAAGGAAGGGGATCCAGTGGG No data
1003144870_1003144879 26 Left 1003144870 6:3501540-3501562 CCTGTTTATGTGAAGGAGTCCCA No data
Right 1003144879 6:3501589-3501611 TAAAAAGGAAGGGGATCCAGTGG No data
1003144870_1003144881 28 Left 1003144870 6:3501540-3501562 CCTGTTTATGTGAAGGAGTCCCA No data
Right 1003144881 6:3501591-3501613 AAAAGGAAGGGGATCCAGTGGGG No data
1003144870_1003144875 11 Left 1003144870 6:3501540-3501562 CCTGTTTATGTGAAGGAGTCCCA No data
Right 1003144875 6:3501574-3501596 AAAGAAATCTGTTTTTAAAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1003144870 Original CRISPR TGGGACTCCTTCACATAAAC AGG (reversed) Intergenic
No off target data available for this crispr