ID: 1003145740

View in Genome Browser
Species Human (GRCh38)
Location 6:3508847-3508869
Sequence AAACAGAAGAAAAATGAGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1003145740_1003145743 -9 Left 1003145740 6:3508847-3508869 CCCTCCTCATTTTTCTTCTGTTT No data
Right 1003145743 6:3508861-3508883 CTTCTGTTTTAGAGTTTTCCTGG No data
1003145740_1003145744 -8 Left 1003145740 6:3508847-3508869 CCCTCCTCATTTTTCTTCTGTTT No data
Right 1003145744 6:3508862-3508884 TTCTGTTTTAGAGTTTTCCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1003145740 Original CRISPR AAACAGAAGAAAAATGAGGA GGG (reversed) Intergenic
No off target data available for this crispr