ID: 1003146138

View in Genome Browser
Species Human (GRCh38)
Location 6:3512121-3512143
Sequence CTAGAGTTCTGAAAGTATCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1003146132_1003146138 11 Left 1003146132 6:3512087-3512109 CCCTTGGGTGAGTGCAGCCACTT No data
Right 1003146138 6:3512121-3512143 CTAGAGTTCTGAAAGTATCCAGG No data
1003146128_1003146138 26 Left 1003146128 6:3512072-3512094 CCTGTGTCCCAGCTGCCCTTGGG No data
Right 1003146138 6:3512121-3512143 CTAGAGTTCTGAAAGTATCCAGG No data
1003146133_1003146138 10 Left 1003146133 6:3512088-3512110 CCTTGGGTGAGTGCAGCCACTTT No data
Right 1003146138 6:3512121-3512143 CTAGAGTTCTGAAAGTATCCAGG No data
1003146131_1003146138 18 Left 1003146131 6:3512080-3512102 CCAGCTGCCCTTGGGTGAGTGCA No data
Right 1003146138 6:3512121-3512143 CTAGAGTTCTGAAAGTATCCAGG No data
1003146130_1003146138 19 Left 1003146130 6:3512079-3512101 CCCAGCTGCCCTTGGGTGAGTGC No data
Right 1003146138 6:3512121-3512143 CTAGAGTTCTGAAAGTATCCAGG No data
1003146134_1003146138 -6 Left 1003146134 6:3512104-3512126 CCACTTTGCCTCCATTCCTAGAG No data
Right 1003146138 6:3512121-3512143 CTAGAGTTCTGAAAGTATCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1003146138 Original CRISPR CTAGAGTTCTGAAAGTATCC AGG Intergenic
No off target data available for this crispr