ID: 1003147481

View in Genome Browser
Species Human (GRCh38)
Location 6:3520873-3520895
Sequence TGCTGAAGACCCTGCTGTGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1003147472_1003147481 29 Left 1003147472 6:3520821-3520843 CCCTCAGGGTTTGGAGGGTCACC No data
Right 1003147481 6:3520873-3520895 TGCTGAAGACCCTGCTGTGCTGG No data
1003147473_1003147481 28 Left 1003147473 6:3520822-3520844 CCTCAGGGTTTGGAGGGTCACCA No data
Right 1003147481 6:3520873-3520895 TGCTGAAGACCCTGCTGTGCTGG No data
1003147478_1003147481 8 Left 1003147478 6:3520842-3520864 CCAGTAGGGCTTCTGGAGATGGG No data
Right 1003147481 6:3520873-3520895 TGCTGAAGACCCTGCTGTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1003147481 Original CRISPR TGCTGAAGACCCTGCTGTGC TGG Intergenic
No off target data available for this crispr