ID: 1003149102

View in Genome Browser
Species Human (GRCh38)
Location 6:3533694-3533716
Sequence CAGAACAAACAGATGGAGAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1003149095_1003149102 30 Left 1003149095 6:3533641-3533663 CCTCTCTGACTTACGTGTCTCAT No data
Right 1003149102 6:3533694-3533716 CAGAACAAACAGATGGAGACAGG No data
1003149097_1003149102 0 Left 1003149097 6:3533671-3533693 CCTGTGCCACAGCTGGCTGTTCC No data
Right 1003149102 6:3533694-3533716 CAGAACAAACAGATGGAGACAGG No data
1003149098_1003149102 -6 Left 1003149098 6:3533677-3533699 CCACAGCTGGCTGTTCCCAGAAC No data
Right 1003149102 6:3533694-3533716 CAGAACAAACAGATGGAGACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1003149102 Original CRISPR CAGAACAAACAGATGGAGAC AGG Intergenic
No off target data available for this crispr