ID: 1003153973

View in Genome Browser
Species Human (GRCh38)
Location 6:3575710-3575732
Sequence TCAGTACCACTCTTTGATCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1003153972_1003153973 7 Left 1003153972 6:3575680-3575702 CCATTTCTTTTGCTGCTTTGACT No data
Right 1003153973 6:3575710-3575732 TCAGTACCACTCTTTGATCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1003153973 Original CRISPR TCAGTACCACTCTTTGATCC AGG Intergenic
No off target data available for this crispr