ID: 1003161961

View in Genome Browser
Species Human (GRCh38)
Location 6:3643843-3643865
Sequence TGGTGTATTACCTACCACCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1003161961_1003161965 17 Left 1003161961 6:3643843-3643865 CCCTGGTGGTAGGTAATACACCA No data
Right 1003161965 6:3643883-3643905 AATGGTTTGATACTCCCCCACGG No data
1003161961_1003161964 -1 Left 1003161961 6:3643843-3643865 CCCTGGTGGTAGGTAATACACCA No data
Right 1003161964 6:3643865-3643887 AGTCACATCTCTGCAGTGAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1003161961 Original CRISPR TGGTGTATTACCTACCACCA GGG (reversed) Intergenic
No off target data available for this crispr