ID: 1003164601

View in Genome Browser
Species Human (GRCh38)
Location 6:3665267-3665289
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1003164601_1003164608 21 Left 1003164601 6:3665267-3665289 CCCTCCACCTTCTCCTAATAAGC No data
Right 1003164608 6:3665311-3665333 TAGCCAGCATTGCCCCATGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1003164601 Original CRISPR GCTTATTAGGAGAAGGTGGA GGG (reversed) Intergenic
No off target data available for this crispr