ID: 1003166157

View in Genome Browser
Species Human (GRCh38)
Location 6:3680189-3680211
Sequence CCTCCGTGTCACCAGTTGAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1003166149_1003166157 26 Left 1003166149 6:3680140-3680162 CCATCCTCTTTGGAGTGATTCTA No data
Right 1003166157 6:3680189-3680211 CCTCCGTGTCACCAGTTGAGAGG No data
1003166150_1003166157 22 Left 1003166150 6:3680144-3680166 CCTCTTTGGAGTGATTCTAGCTC No data
Right 1003166157 6:3680189-3680211 CCTCCGTGTCACCAGTTGAGAGG No data
1003166152_1003166157 -8 Left 1003166152 6:3680174-3680196 CCAAAAACATAGCCCCCTCCGTG No data
Right 1003166157 6:3680189-3680211 CCTCCGTGTCACCAGTTGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1003166157 Original CRISPR CCTCCGTGTCACCAGTTGAG AGG Intergenic
No off target data available for this crispr