ID: 1003171271

View in Genome Browser
Species Human (GRCh38)
Location 6:3723633-3723655
Sequence CTGTCTCGAAGGGGACCAGG TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 113
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 104}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1003171264_1003171271 5 Left 1003171264 6:3723605-3723627 CCTGATAGAGAGGTTCAGTCCCA 0: 1
1: 0
2: 0
3: 4
4: 82
Right 1003171271 6:3723633-3723655 CTGTCTCGAAGGGGACCAGGTGG 0: 1
1: 0
2: 0
3: 8
4: 104

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1003171271 Original CRISPR CTGTCTCGAAGGGGACCAGG TGG Exonic
900129004 1:1079786-1079808 CTGCGACGGAGGGGACCAGGCGG - Intergenic
900297619 1:1959921-1959943 CTCTCTCGAAGGGGAGGTGGTGG - Intronic
900640236 1:3684981-3685003 ATGTCCAGAAGGGGACCTGGAGG - Intronic
903982712 1:27201431-27201453 CCGCCTCGAAGGTGACCCGGCGG + Intergenic
904326439 1:29729661-29729683 CTGCCTGGAAGGTGACCTGGGGG + Intergenic
904614905 1:31744346-31744368 CTCTCTCGTAGGCGACCCGGCGG - Exonic
911945873 1:104108258-104108280 GTGTCAAGGAGGGGACCAGGTGG + Intergenic
915145634 1:153794447-153794469 GTGGCTAGAAGGGGACCTGGGGG + Intergenic
921167717 1:212518881-212518903 TTGTTTCCAAGGGGACCAGCAGG - Intergenic
922224395 1:223632777-223632799 CTAGCTCGAAGGTGGCCAGGAGG - Intronic
922365203 1:224856766-224856788 GTGTCAAGAACGGGACCAGGTGG + Intergenic
1067087964 10:43252847-43252869 CTGTGTCGAGGGTGAGCAGGAGG - Intronic
1069597604 10:69682502-69682524 CTGGCTGGAAGGGTACCAAGGGG - Intergenic
1069918348 10:71800856-71800878 GTGTCTCAAAGGGGACCGGGGGG - Intronic
1072917229 10:99545537-99545559 CTGTCTCGAGGAGGAAGAGGAGG + Intergenic
1073541967 10:104322206-104322228 CTGTCTGGAAGGAGAGGAGGAGG - Intronic
1074421939 10:113316872-113316894 CTGTCTTGGAGGGTACAAGGAGG + Intergenic
1077072789 11:684694-684716 ATGTCTCGATGGGGAACACGTGG - Intronic
1084311229 11:68317403-68317425 TTGTCCAGATGGGGACCAGGAGG + Intronic
1094523904 12:31219380-31219402 CTGTCACAAAGGGGACAAGAAGG - Intergenic
1094682726 12:32679809-32679831 CTGCCTCCAAGGGCACCTGGGGG + Intronic
1096355595 12:50938233-50938255 AAGTCTGGAAGGGGCCCAGGTGG + Intergenic
1097189153 12:57211297-57211319 CTGTCTCGAAGGGGCCTGTGTGG + Exonic
1097253826 12:57656699-57656721 CAGTCTGGAAGGGGACTCGGGGG - Intergenic
1102597596 12:114004756-114004778 CAGGGTGGAAGGGGACCAGGAGG - Intergenic
1104133016 12:125912951-125912973 GTGTCAAGAAAGGGACCAGGCGG + Intergenic
1118257042 14:64214424-64214446 CTCTCACGAAGAGGACGAGGAGG + Exonic
1119757050 14:77126548-77126570 CTGTGTAGGAGGGGACCAGGGGG - Intronic
1121980955 14:98453179-98453201 GTGTCTTGAGAGGGACCAGGTGG - Intergenic
1124436949 15:29658122-29658144 ATGTCTTGGGGGGGACCAGGTGG + Intergenic
1124628579 15:31324986-31325008 CTGGCTGGAAAGGGGCCAGGAGG + Intergenic
1129670369 15:77604523-77604545 CTGTCTCCTAGGCGACCAGCTGG - Intergenic
1131587419 15:93710999-93711021 CTGTCTAGAAGGGGAAAAAGAGG - Intergenic
1132862639 16:2079184-2079206 CTGTCCCGAAGAGGTCCAGGCGG + Exonic
1134084900 16:11349606-11349628 CTGTCACGGAGGGACCCAGGTGG + Intronic
1134119593 16:11574411-11574433 TTGTCGGGAAGGGAACCAGGTGG + Intronic
1138159761 16:54741988-54742010 CTATCTCTAAGGGGACCATAGGG + Intergenic
1142427798 16:90009836-90009858 CTGGTTTGAAGGGGACCAAGAGG - Intronic
1148115105 17:45170875-45170897 CAGTCTGCAAGGGCACCAGGAGG - Intergenic
1150637928 17:66929227-66929249 ATGTCTCGAGAGGGACCTGGTGG + Intergenic
1152199328 17:78935950-78935972 ATGTCTCGAGTGGGACCTGGAGG + Intergenic
1152834561 17:82520497-82520519 CTGCCAGGAAGGGGACCGGGAGG - Intronic
1154162391 18:11990032-11990054 CTGTCTCCACTGGGCCCAGGAGG - Intronic
1157369270 18:47095345-47095367 CTGTCAAGGACGGGACCAGGTGG + Intronic
1158020478 18:52836180-52836202 ATGTCATGAAAGGGACCAGGTGG - Intronic
1158392073 18:57052055-57052077 CTGGCCCCAAGGTGACCAGGAGG + Intergenic
1158561145 18:58514937-58514959 CTGACTCGTTGGGGACTAGGAGG - Intronic
1161945589 19:7434449-7434471 CTTTCTGCAAGGGGACCTGGAGG - Intronic
1165348813 19:35265799-35265821 CAATCTGGAAGGTGACCAGGTGG + Intronic
1165734025 19:38164565-38164587 CTGGCTCCAGGGGGTCCAGGGGG - Exonic
1166375474 19:42324791-42324813 AGGTCTCGAAGGGGGCCAGGGGG - Exonic
927255595 2:21037984-21038006 CTGTCTCTGGGGGAACCAGGAGG + Exonic
929114919 2:38435830-38435852 CTTTCTTGCAGGGGACCAAGTGG - Intergenic
929160082 2:38822924-38822946 AGGTCTCTAAGGGGACCATGGGG - Intronic
934847625 2:97672408-97672430 CTGCCTGGCAGGTGACCAGGAGG + Intergenic
934849389 2:97687824-97687846 CTGCCTGGCAGGTGACCAGGAGG + Intergenic
935820937 2:106892193-106892215 CTGTCTCAAAGAGGAACAGAAGG + Intergenic
937292061 2:120787704-120787726 CTGTCTGCAAGGGGAACAAGGGG - Intronic
937878890 2:126850391-126850413 GTTTCTTGAATGGGACCAGGCGG - Intergenic
946846472 2:223863116-223863138 ATGTCTCGGAAGAGACCAGGTGG - Intronic
1168833486 20:860553-860575 CTGTCTGGGATGGAACCAGGGGG + Intergenic
1173443397 20:43096854-43096876 CTGTCTGGAAGGGGAGCCTGGGG - Intronic
1173953010 20:47007964-47007986 CTGGCTCAGAGGGGATCAGGAGG + Intronic
1174207033 20:48847782-48847804 CTGACTGGAAGGGGACCCGGGGG - Intergenic
1175754680 20:61522101-61522123 CTGTCACGAGGGAGGCCAGGTGG - Intronic
1175952630 20:62591441-62591463 CTGTCTTGATGGGGCTCAGGTGG + Intergenic
1180189853 21:46157657-46157679 GTGTCTGGAGGGAGACCAGGAGG + Intergenic
1181810415 22:25400644-25400666 TTGTCCAGATGGGGACCAGGAGG - Intronic
1184066903 22:42126396-42126418 CTGTCTCAAATGCGGCCAGGCGG + Intergenic
1184452138 22:44589497-44589519 CTGGCATCAAGGGGACCAGGAGG - Intergenic
956095779 3:65714453-65714475 GTGATTCGAAGGGGCCCAGGTGG - Intronic
960823363 3:121757780-121757802 CATTCTGGAAGGGGACAAGGAGG + Intergenic
965426450 3:168529914-168529936 GTGTCATGAAGGGGACCTGGTGG - Intergenic
966822841 3:183938634-183938656 CTGTTCCTAAGGTGACCAGGAGG - Intronic
967260734 3:187639278-187639300 CTGTCTGGAAGATGACAAGGTGG - Intergenic
967935741 3:194726035-194726057 CTGTCACGCAGGGCACCATGGGG - Intergenic
968730676 4:2267922-2267944 CTGTGTCCAAGGGGCTCAGGAGG - Intergenic
969712855 4:8854103-8854125 CTGCCTCGAATGGGTCCTGGAGG + Intronic
969892496 4:10272733-10272755 CCGTTTCAGAGGGGACCAGGAGG - Intergenic
981885040 4:149664743-149664765 CTGTCTGGAAAGGCAACAGGTGG + Intergenic
987605795 5:20134571-20134593 ATGTCACGGAAGGGACCAGGTGG - Intronic
988035666 5:25824066-25824088 CTGTCTCTAAGGAGACCTGGAGG - Intergenic
990649922 5:57886916-57886938 CTGTCTCGCAGGGGGCAGGGGGG - Intergenic
990671023 5:58130288-58130310 CTGTCTCGAAAGGGAAGGGGAGG - Intergenic
1001930982 5:175672826-175672848 CTGCCTTGGAGGGGTCCAGGAGG + Intronic
1002783527 6:384394-384416 CTGCCTAGCTGGGGACCAGGTGG + Intergenic
1003171271 6:3723633-3723655 CTGTCTCGAAGGGGACCAGGTGG + Exonic
1006491704 6:34393018-34393040 CGGTCTCGAAGGGGTTGAGGGGG + Intronic
1009500810 6:64410467-64410489 CTGTCTCTAAGGGGAAAAGATGG + Intronic
1010370609 6:75102667-75102689 ATGTCTCCACGAGGACCAGGGGG + Exonic
1012420825 6:99063463-99063485 CTGCCTGGAAGGGGAAAAGGAGG + Intergenic
1015594973 6:134858026-134858048 GTGACTTGATGGGGACCAGGAGG - Intergenic
1018575229 6:165252768-165252790 ATGTGTCAAGGGGGACCAGGTGG - Intergenic
1021135875 7:16964685-16964707 CTGTGTGGAAGGTGACCAGAGGG - Intergenic
1027238894 7:76314484-76314506 CTCTCTGGGAGGGCACCAGGGGG - Intergenic
1027551905 7:79608699-79608721 ATGTCTAGGAGGGGACGAGGAGG + Intergenic
1028757282 7:94452334-94452356 CTGCCTCAAAGGGAACCAGCTGG + Intergenic
1029548401 7:101223368-101223390 CTGTCTCAAAAAGAACCAGGAGG + Intronic
1032047148 7:128620031-128620053 CTGTCACCAAGGTGACCAGTAGG - Intergenic
1032578573 7:133081895-133081917 CCGCCTCGAAGGTGACCCGGCGG + Exonic
1032848521 7:135772457-135772479 CTATCTCACTGGGGACCAGGTGG + Intergenic
1033136307 7:138787338-138787360 CTTTCTAGAAGGGGAACACGAGG - Intronic
1033150171 7:138907536-138907558 CGCTCTCCAAGAGGACCAGGAGG + Intronic
1036114967 8:5949172-5949194 CTGTCATGAAAGGGACCAGGTGG + Intergenic
1042498617 8:69484871-69484893 CTGTCTCGAAGAGGAGGAGGAGG - Intronic
1047572780 8:126118709-126118731 CTGTCTCGAGGAGGAGGAGGAGG - Intergenic
1047591187 8:126329288-126329310 GTGTCAAGAATGGGACCAGGTGG + Intergenic
1050304988 9:4298248-4298270 CTGGCTCGGCGGGGACCGGGGGG - Intronic
1052282383 9:26748085-26748107 CTGTCACGGAAGGGACCTGGTGG + Intergenic
1057941849 9:99292004-99292026 CTGCCTCTCAGGGGACCATGAGG - Intergenic
1185593918 X:1295781-1295803 CTGTCTACACGGGGTCCAGGTGG - Intronic
1196814931 X:119657454-119657476 ATGTCTAGAGGGGGACAAGGAGG - Intronic
1199609287 X:149599498-149599520 GTGTCTGGGGGGGGACCAGGGGG - Intronic