ID: 1003172036

View in Genome Browser
Species Human (GRCh38)
Location 6:3727458-3727480
Sequence CTGTTCTTATGGAAGGAAGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 246
Summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 232}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1003172036_1003172040 -3 Left 1003172036 6:3727458-3727480 CCCACTTCCTTCCATAAGAACAG 0: 1
1: 0
2: 1
3: 12
4: 232
Right 1003172040 6:3727478-3727500 CAGTGAGCCCCCATCCCACAAGG 0: 1
1: 0
2: 1
3: 30
4: 229
1003172036_1003172042 4 Left 1003172036 6:3727458-3727480 CCCACTTCCTTCCATAAGAACAG 0: 1
1: 0
2: 1
3: 12
4: 232
Right 1003172042 6:3727485-3727507 CCCCCATCCCACAAGGCAAATGG 0: 1
1: 0
2: 0
3: 22
4: 207
1003172036_1003172046 10 Left 1003172036 6:3727458-3727480 CCCACTTCCTTCCATAAGAACAG 0: 1
1: 0
2: 1
3: 12
4: 232
Right 1003172046 6:3727491-3727513 TCCCACAAGGCAAATGGCTCAGG 0: 1
1: 0
2: 2
3: 13
4: 149

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1003172036 Original CRISPR CTGTTCTTATGGAAGGAAGT GGG (reversed) Intronic
902126345 1:14215368-14215390 CTGTTCATCAGGAAGGAATTTGG - Intergenic
905637206 1:39562292-39562314 CTCTTCTTCTGCAAGCAAGTGGG + Intronic
906423391 1:45688805-45688827 CTATACTTAAGGAAGCAAGTAGG - Intronic
907418221 1:54329112-54329134 CTGGACTTCTGGAAGGAAGGGGG + Intronic
907882292 1:58562029-58562051 CTATTGTGATGGAATGAAGTGGG + Intergenic
908580596 1:65512196-65512218 CTGTTCTTGTGGTAGTGAGTGGG - Intronic
908692909 1:66802913-66802935 CTGTTCTTCTGTAGGGAAGCTGG + Intergenic
909058080 1:70845974-70845996 CTGTTCTCATGGCAGTGAGTAGG + Intergenic
909095080 1:71276316-71276338 CTGTTCTTCTGAAAGTGAGTGGG + Intergenic
911741221 1:101388381-101388403 CTGTTCTCATGATAGGAAATGGG - Intergenic
912583817 1:110743577-110743599 CTGTACTAATATAAGGAAGTGGG + Intergenic
912703908 1:111897954-111897976 CCGTGTTTATGGAAGGAAGGTGG - Intronic
913118257 1:115716402-115716424 CTGTGCTTAGGAAATGAAGTAGG - Intronic
914876117 1:151513649-151513671 CTGGACTTCTGGCAGGAAGTGGG - Intronic
916944801 1:169715741-169715763 CTGAACTTATGGCAGGAACTTGG + Intronic
917563690 1:176188004-176188026 CTGATCTCATGGAGGGAAGAGGG - Intronic
918778338 1:188666539-188666561 CTTTTATTAGGGAAGGAAGTTGG - Intergenic
921018849 1:211217691-211217713 ATGATATGATGGAAGGAAGTGGG + Intergenic
923029248 1:230234256-230234278 CTGTGCTTCTGAAGGGAAGTTGG + Intronic
924282997 1:242456896-242456918 CTGCGCATATGGAAGGAATTAGG - Intronic
1065862077 10:29880302-29880324 CTTCTCTCATGGAAGGCAGTGGG + Intergenic
1066676660 10:37894744-37894766 GTATTTTTATGGAAGGAAGTTGG - Intergenic
1068533549 10:58215153-58215175 TTGTTCTTGTGTCAGGAAGTTGG - Intronic
1071021310 10:81060381-81060403 CCATTCATATGGAAGGAAGTTGG - Intergenic
1071820912 10:89279757-89279779 CTGTACTTAAGTAAGGAAGTGGG + Intronic
1072550818 10:96475861-96475883 CTGTTCTCATGATAGTAAGTGGG + Intronic
1073874043 10:107900620-107900642 ATGTCCTTAAGGAAGCAAGTTGG + Intergenic
1074195785 10:111183562-111183584 CTGTTTTTATTTAAAGAAGTTGG + Intergenic
1075385597 10:122053323-122053345 CTGTTCTCATGATAGGGAGTGGG - Intronic
1079041377 11:17063483-17063505 CTGTTCTGAAGGAGGGGAGTTGG - Intergenic
1079525830 11:21386447-21386469 CTTTGTCTATGGAAGGAAGTGGG - Intronic
1079640602 11:22800208-22800230 TTGTTCTTATGGAGGGATGAGGG + Intronic
1080907779 11:36563988-36564010 GTGATCTTATGGAGGTAAGTAGG + Intronic
1081005743 11:37735898-37735920 CTGTCTTTAAGGAAGAAAGTAGG - Intergenic
1081032367 11:38100266-38100288 TTGTTGTTAAGAAAGGAAGTGGG + Intergenic
1081635004 11:44715276-44715298 CTGTTCTTATGACAGTGAGTGGG - Intergenic
1082812595 11:57487464-57487486 CTGTTATTAGTGGAGGAAGTGGG - Intronic
1082999132 11:59275693-59275715 CTTTTGTTAGGGAATGAAGTGGG - Intergenic
1083553326 11:63607087-63607109 CTGTGCTGATGGAATGAGGTGGG + Intronic
1083988891 11:66234463-66234485 CTGTTCATCTGGAAGGAACAAGG + Intronic
1085272206 11:75277085-75277107 CTTTGGTTATGGAAGGAAATGGG - Intronic
1088662683 11:112063750-112063772 CCTTTCTTTTGGAAGGAAGGAGG + Exonic
1089146744 11:116335009-116335031 CTGTTCCAATGGATGGATGTGGG - Intergenic
1089812873 11:121145969-121145991 CAGTTCTTATAGAAGAAGGTGGG - Exonic
1090254314 11:125272687-125272709 CTGTTCCTCTTGGAGGAAGTGGG - Intronic
1091158794 11:133400016-133400038 ATGTTCTTATGGAAGACAGGTGG - Intronic
1096052062 12:48619003-48619025 ATGTTCTCATGGAAGAAAGAGGG + Intergenic
1097606561 12:61761932-61761954 CTGTTCTTGTGAAAGAAATTTGG + Intronic
1098858126 12:75677292-75677314 CTGTTCTTTAGGAATGAACTAGG - Intergenic
1099044712 12:77702533-77702555 CTGTTTTTATGAAAGAAAGCAGG - Intergenic
1099641754 12:85297626-85297648 TTTTTCATTTGGAAGGAAGTTGG + Intronic
1100044020 12:90356656-90356678 ATTTTCTTATGGAATGAAATTGG - Intergenic
1100772192 12:97935668-97935690 CTGTTCTAAGGGAAGGATTTAGG + Intergenic
1101406429 12:104433132-104433154 GTGTTTTTAGGGAAGGAAGGCGG - Intergenic
1101430763 12:104625068-104625090 CTGGTGTTATGGAATGAGGTGGG - Intronic
1102379917 12:112456244-112456266 GTGTTCTGAGGGAAGGGAGTTGG + Intronic
1105543301 13:21333402-21333424 CTGTTCTTATGGTTGTAAGCAGG + Intergenic
1107162085 13:37242031-37242053 CTTTTCATGTGGAAGGAATTAGG + Intergenic
1107645045 13:42485483-42485505 CTGTTCTCATGGCAGGAGGCAGG - Intergenic
1109481968 13:62966810-62966832 ATGTTAATAAGGAAGGAAGTTGG + Intergenic
1111841661 13:93456964-93456986 CTGTTCTCATGATAGTAAGTGGG + Intronic
1112326799 13:98446976-98446998 CTGTTCTCATGGCAGAAAGTGGG + Intronic
1114680341 14:24479093-24479115 CTGTTCTTGTGAAAGTGAGTGGG - Intergenic
1116979906 14:51157607-51157629 GTGATATTATGGAAGAAAGTTGG + Intergenic
1117195244 14:53333646-53333668 GTGTTGTTATGCTAGGAAGTAGG - Intergenic
1118081152 14:62362213-62362235 CTGTTCTTGAGGATGGAAGCTGG + Intergenic
1119012374 14:71006868-71006890 TTGTTCTTTTGGAGTGAAGTTGG + Intronic
1120919269 14:89740002-89740024 CTGTCCTTTTTGAAGGATGTAGG - Intergenic
1122644367 14:103183657-103183679 CTAATTTTATGGAAGAAAGTTGG - Intergenic
1124149648 15:27166132-27166154 CTTTTATTTTAGAAGGAAGTTGG + Intronic
1125884818 15:43220733-43220755 CTGTTTTCATTAAAGGAAGTGGG - Exonic
1126925165 15:53577126-53577148 CTGTTCGTATGAAAGAAACTTGG + Intronic
1130676710 15:85959221-85959243 CTGTCCTTATGGAACAAAGGAGG + Intergenic
1131175619 15:90207630-90207652 CTGTTCTAATGGAAAGAATGTGG - Intronic
1131463965 15:92639688-92639710 CTGTTCTTATGATAGTGAGTGGG + Intronic
1133190760 16:4132033-4132055 CTGTGCTTATTAAAGAAAGTTGG - Intergenic
1134344735 16:13379258-13379280 ATCTTATTTTGGAAGGAAGTGGG + Intergenic
1137306806 16:47208863-47208885 TTGTACTCATGGAAGGAAGATGG - Intronic
1140999012 16:80290314-80290336 CTGTTCTACTGGAAGCCAGTGGG + Intergenic
1142797970 17:2323632-2323654 CTGTTGATATGGAAGGGAGTAGG - Exonic
1145356821 17:22165948-22165970 ATGTTAATAAGGAAGGAAGTTGG - Intergenic
1146397031 17:32476521-32476543 CTGTTCTTATATAAGCATGTAGG + Intronic
1154390080 18:13929311-13929333 ATGTTCCTATGAAAGGAAGCAGG + Intergenic
1158067784 18:53433811-53433833 CTGTGAGTATGTAAGGAAGTAGG - Intronic
1158820502 18:61153326-61153348 CTTTTCTTATGGAAAGAAGTGGG + Intergenic
1159917818 18:74201954-74201976 GTGTTCTTATGGGAAGAGGTGGG + Intergenic
1160218161 18:76952474-76952496 CTGTGCTTCTGGGAGGAAGCTGG + Intronic
1161253823 19:3295432-3295454 CTACTCGGATGGAAGGAAGTCGG - Intronic
1161988804 19:7672254-7672276 CTGTTTTCATGGAAGACAGTTGG + Intergenic
1162744344 19:12790362-12790384 CTGTTTCTAAGGAAGGGAGTGGG + Intronic
1165528672 19:36378622-36378644 CTGTTCTTTAGGAAGGCAGCGGG - Intronic
1168070695 19:53949620-53949642 CTGTCCTAAAGGAAGAAAGTGGG - Intergenic
925728113 2:6894218-6894240 CTCTTCCTTTGGAAGGCAGTGGG - Intronic
929652743 2:43698096-43698118 CTCTTCTGGGGGAAGGAAGTTGG - Intronic
930496459 2:52151020-52151042 CTGTTCTCATGATAGCAAGTCGG - Intergenic
930905344 2:56559507-56559529 CTCGTCTTATGGATGGAAGCAGG + Intergenic
930930660 2:56877690-56877712 CTGTCCTTATAGAATGAATTAGG - Intergenic
931146370 2:59523762-59523784 CTGTTCTTCTGAGATGAAGTGGG - Intergenic
931803342 2:65779743-65779765 CTGTTCTTATCCAAGAAGGTGGG - Intergenic
933113463 2:78434681-78434703 CTGTTTTTATTGAAGAAAGAAGG - Intergenic
933810192 2:86028251-86028273 CTGTGCTGCTGGAAGGAAGCGGG - Intronic
934020171 2:87941730-87941752 CTATTCTTAGGAAAGGAATTTGG + Intergenic
936697898 2:114972872-114972894 CAGTTCTTTTGGAAGGACGAAGG + Intronic
937159346 2:119745755-119745777 CTGGTTCTGTGGAAGGAAGTTGG - Intergenic
939983153 2:148805104-148805126 CTGGCCTCATGGAATGAAGTGGG + Intergenic
940914324 2:159237948-159237970 GAATTCCTATGGAAGGAAGTTGG - Intronic
943678568 2:190742977-190742999 GTGTTCCTAGGGAAGGAAGAAGG + Intergenic
944191396 2:197008257-197008279 CTGCTCTGATGGAAGCAAGAGGG - Intronic
947264868 2:228267317-228267339 CTGTTCTCATGGTAGTGAGTGGG - Intergenic
948169001 2:235886068-235886090 TTGTTCTGATGGATGGAAGCTGG - Intronic
948416431 2:237808935-237808957 CTATTCCTATGGAAGAAAGCTGG - Intronic
1168930079 20:1614632-1614654 CAGTTCCTAGAGAAGGAAGTAGG - Intronic
1170345978 20:15387575-15387597 CTTCCTTTATGGAAGGAAGTGGG - Intronic
1170710876 20:18789633-18789655 CTGTCCTTATGGGAAGAAGCAGG - Intergenic
1170746542 20:19104324-19104346 CTGTTCATATGGGAGTGAGTAGG - Intergenic
1170815118 20:19707418-19707440 CTGTTCATGCGGAAGTAAGTCGG + Intronic
1171996252 20:31733947-31733969 CTGTTCATTTGGAAGGAATTGGG + Intergenic
1172297161 20:33821016-33821038 GTCTTCCTACGGAAGGAAGTAGG + Intronic
1172406462 20:34693546-34693568 CTGTCCTTGGGGAAGGCAGTGGG - Intergenic
1173278482 20:41605334-41605356 CCATTCTAATGGAAGGGAGTTGG - Intronic
1173460163 20:43236811-43236833 ATGTTCATATGACAGGAAGTGGG + Intergenic
1174936194 20:54872532-54872554 ATTTTCTTTTGGAAGTAAGTGGG + Intergenic
1175448878 20:59045514-59045536 GGGTCCTTATGGAAGGTAGTGGG + Intergenic
1177955143 21:27589028-27589050 CTGTTTTTATGGAAGTAAAGAGG + Intergenic
1178148858 21:29770681-29770703 ATGTTCTTGTTGAAGCAAGTTGG - Intronic
1178531307 21:33378571-33378593 CTGTCCTAATAGAAGGAAGCTGG - Intergenic
1179106318 21:38403797-38403819 CTGTGCTTGTGGAAGGCAGCTGG - Intronic
949151838 3:778458-778480 CTTTTCTTATTCAAGAAAGTTGG + Intergenic
949364650 3:3267730-3267752 CTGTTCTATGGGAAGGTAGTGGG + Intergenic
951946157 3:28139014-28139036 CTGTTCTTCAGGTAGGAACTTGG - Intergenic
953060214 3:39421728-39421750 CTGTTAGTATGGAAGAAAGGAGG - Intergenic
953718178 3:45333535-45333557 CTGTGCAGATGGAAGGAAGTGGG + Intergenic
954393442 3:50279499-50279521 CAGCTCTTAAGGAAGGAAGCTGG + Intronic
955343210 3:58141695-58141717 CTGCCCTTTTGGAAGGCAGTTGG - Intronic
955897636 3:63717571-63717593 ATGTTCTTATGAATGGAAGAGGG - Intergenic
956005277 3:64771986-64772008 TTGTTCATAGGGAAGGAACTGGG + Intergenic
956016026 3:64883874-64883896 AAGTTCTTTTGGAAGGAGGTGGG - Intergenic
956737752 3:72251384-72251406 CTCTGCTTATGGAATGAGGTTGG - Intergenic
957220859 3:77380721-77380743 CTGTGATGATGGAAGGAAGGAGG - Intronic
957262872 3:77922947-77922969 CTTTGGTTAGGGAAGGAAGTGGG - Intergenic
957407611 3:79791528-79791550 CTGTTCTCATGGTAGTAAATGGG - Intergenic
959007886 3:101041057-101041079 CTGCTCTGATGGAGGGAAGGAGG - Intergenic
959372940 3:105551809-105551831 CTTTTTTTAGGGAAGCAAGTCGG - Intronic
959483170 3:106897950-106897972 GTGTGCTTGTGGTAGGAAGTAGG + Intergenic
960455378 3:117864581-117864603 TTGTTGTTATGGAAGGAATGTGG - Intergenic
960845939 3:122004838-122004860 TTGTTCACATGGAAGGAAATAGG - Intronic
964666375 3:159178642-159178664 CTGCTCTATTGGAAGGAAGTGGG + Intronic
964880306 3:161416486-161416508 CTGTTCTTGTGGTAGGAAGGAGG + Intergenic
965812916 3:172610258-172610280 CTGTGCTTCTGGCAGGAAGAGGG + Intergenic
967134419 3:186501523-186501545 CTCTTGTTATATAAGGAAGTTGG + Intergenic
973019387 4:45182808-45182830 CTGTAATTATGGAAGACAGTGGG + Intergenic
975094959 4:70447042-70447064 ATGATATTATGGAAGGAATTGGG + Intronic
976171661 4:82310952-82310974 CTCTCCTTATGGAAGGGAGAGGG - Intergenic
977645482 4:99407024-99407046 CTGCTCTGATGGAAAGAAGGAGG + Intergenic
981985277 4:150846816-150846838 CTGTTCTTATATATGGAAATGGG - Intronic
983863824 4:172739343-172739365 CTGTCCTTATGACAAGAAGTAGG - Intronic
984715026 4:182917359-182917381 CCGTGCTCAGGGAAGGAAGTCGG + Exonic
988084583 5:26459052-26459074 GTGTTCCTAGGGAAAGAAGTGGG - Intergenic
988298133 5:29391629-29391651 CTTTTCTTCTGGAAGGAGGGTGG - Intergenic
992437043 5:76764459-76764481 CTTTTATTATGAAAGGATGTTGG + Intergenic
993685642 5:90934096-90934118 CTGTTCTTCTTGCTGGAAGTTGG + Intronic
994580928 5:101641027-101641049 CTGTGTTTATGGAAGGGAGAGGG - Intergenic
995096417 5:108240468-108240490 CTCTTCTTATGGAAAGGGGTAGG + Intronic
996978633 5:129462300-129462322 CTGTTCTTGTGAAAGGAGTTGGG + Intronic
998078892 5:139258455-139258477 CTGTTCTTCTGGAAAGAAAATGG - Intronic
998255473 5:140583876-140583898 ATTTTCTTATGAAAGGATGTTGG - Intronic
998374817 5:141683200-141683222 CTGTTTGTATGAGAGGAAGTTGG + Intergenic
999038336 5:148378911-148378933 CTGTTCTTACGAAAGTGAGTGGG - Intergenic
999352379 5:150886404-150886426 CTGTTTTTATAGAATGAATTGGG + Intronic
999521970 5:152359981-152360003 TTGTTCTCTTGGCAGGAAGTGGG - Intergenic
999978014 5:156931335-156931357 CTGTTCTTTTGGAAGGTCTTAGG - Intronic
1000382542 5:160642044-160642066 CTGTTCTTTTGGAAAGAGTTGGG + Intronic
1001545853 5:172570142-172570164 CTGTTCTGAGGGAAGGTGGTGGG + Intergenic
1003172036 6:3727458-3727480 CTGTTCTTATGGAAGGAAGTGGG - Intronic
1003339062 6:5202439-5202461 CTGTTTGTATGTAAGGAGGTTGG - Intronic
1003735150 6:8869715-8869737 CTGTTCTTATGGAACTGAGCTGG + Intergenic
1004791002 6:19026412-19026434 CAGTTCATATGGCAGGAATTTGG + Intergenic
1005101287 6:22174742-22174764 CTGGTCTTATAGAATGAATTTGG + Intergenic
1005256991 6:24013888-24013910 CTGTTCTTATGATAGTAAATGGG + Intergenic
1009056012 6:58335946-58335968 CTGCTCTAATGTAAAGAAGTAGG - Intergenic
1009720382 6:67461049-67461071 CTGTTCTTCTGGAACTAAATTGG - Intergenic
1010046005 6:71444359-71444381 GTGTTATTTTGTAAGGAAGTAGG - Intergenic
1010149322 6:72711801-72711823 TTTTTCAGATGGAAGGAAGTTGG + Intronic
1011237801 6:85236920-85236942 CTGATCTTAAAGAAGGAAGATGG + Intergenic
1011504264 6:88023733-88023755 CTGTTCTTATGGAAGTTTGGCGG - Intergenic
1013452790 6:110301437-110301459 CTTGCTTTATGGAAGGAAGTGGG + Intronic
1013883177 6:114929587-114929609 GTGTTATTATGAAAGGATGTTGG + Intergenic
1014091747 6:117411679-117411701 CAGTTCATATGGAGGGCAGTGGG - Intronic
1016126447 6:140409306-140409328 CTGTTCTCATGGTAGTGAGTGGG + Intergenic
1016139603 6:140592979-140593001 CTGTTCTCATGAAAGTAAATGGG + Intergenic
1017545304 6:155444751-155444773 ATGTTCTGATGGATGGCAGTCGG + Intronic
1017565391 6:155679436-155679458 CAGCTCATAAGGAAGGAAGTGGG + Intergenic
1017585326 6:155914835-155914857 CTGTGCTTATGGAAGGTGCTAGG + Intergenic
1020907749 7:14085672-14085694 CTGTGCTTCTGGAAGGGAGAAGG - Intergenic
1021338918 7:19439244-19439266 TTGTTCTTAAGGGAGGAACTGGG - Intergenic
1021673251 7:23053962-23053984 CTGTTCTTGTGATAGCAAGTAGG - Intergenic
1022469365 7:30672767-30672789 CTGTTCCAAGGGAAGCAAGTTGG + Intronic
1022951283 7:35340490-35340512 CTGTACTTGTGGAAGTAAATCGG + Intergenic
1023742362 7:43292296-43292318 GTGTTCTTATGAAAGCTAGTTGG - Intronic
1027983972 7:85261612-85261634 AAGTTCTTTTGGAAGAAAGTGGG - Intergenic
1028412141 7:90541439-90541461 CTGTTTTCATGGAATGAATTTGG - Intronic
1030703593 7:112668053-112668075 CTTTTCTTCTCTAAGGAAGTTGG + Intergenic
1030932974 7:115548424-115548446 CTGTTCCTTTGAATGGAAGTTGG + Intergenic
1031130694 7:117830020-117830042 CTGTTTCTATGGAATGGAGTAGG - Intronic
1031513023 7:122672218-122672240 CTGTTGTTATGAAAGGATGTAGG - Intronic
1032141865 7:129338596-129338618 CTGTTCTGATGGATGAAAGGTGG + Intronic
1032733091 7:134663903-134663925 CTGTTCTTTTTGAGGGAAATCGG + Intronic
1033322690 7:140354476-140354498 CTGTTCTTATGGAACTTAGCAGG - Intronic
1033872276 7:145769517-145769539 CTGGTCTTATGGAATAAATTAGG + Intergenic
1034706659 7:153151887-153151909 CTGGCCTTATCGAAGGAGGTAGG + Intergenic
1036076883 8:5512263-5512285 CTTGTCTTGTGGCAGGAAGTGGG - Intergenic
1036100903 8:5783586-5783608 CTGTTCTCCTGGAAGTAAATGGG + Intergenic
1036474525 8:9081151-9081173 CTGTTCTCATGATAGTAAGTGGG - Intronic
1036588953 8:10150217-10150239 CTTTTCAAATTGAAGGAAGTGGG + Intronic
1036757991 8:11484100-11484122 CTGTTCTTACCGGAGGAAGGGGG + Intergenic
1037706618 8:21320953-21320975 CTATTCCCATGGAAGGAAGCTGG + Intergenic
1038385937 8:27145244-27145266 CTGTTGTGAAAGAAGGAAGTAGG - Intergenic
1038453804 8:27658364-27658386 CAGGACTTCTGGAAGGAAGTTGG + Intronic
1038843912 8:31211380-31211402 ATGTTCTGATTGAAGGACGTTGG - Intergenic
1043069423 8:75620298-75620320 CTGTTCTTAAGAGAGGAAGGTGG + Intergenic
1045666053 8:104485906-104485928 CTGTTCATCTGGAAATAAGTGGG - Intergenic
1045772745 8:105763310-105763332 CTGTTATTCTGGAAGGAGATTGG - Intronic
1045989144 8:108285522-108285544 CTATTCCTATGGTAAGAAGTAGG + Intronic
1046071871 8:109265501-109265523 ATGTCATTATGAAAGGAAGTAGG - Intronic
1046406706 8:113781954-113781976 CTGTAGTCATGGAAGCAAGTAGG + Intergenic
1047360563 8:124165076-124165098 AGGTTCTGATGGAAGGATGTGGG - Intergenic
1055716978 9:79128512-79128534 ATGTTAGTATGGAAGGAAGCTGG - Intergenic
1055931179 9:81561142-81561164 CTGTTCTCATGGTAGTGAGTAGG + Intergenic
1058479738 9:105379467-105379489 ATGTTATCATTGAAGGAAGTTGG + Intronic
1060072791 9:120564978-120565000 CAGGCCTTATGGTAGGAAGTCGG - Intronic
1060277212 9:122191396-122191418 CTGCCCTGATGGAAGGAATTGGG + Intronic
1061659354 9:132118380-132118402 CTGTTGTTATGAAGGGAAGATGG - Intergenic
1187147269 X:16648530-16648552 CTGTTTTCCTGGGAGGAAGTAGG - Intronic
1187482519 X:19670932-19670954 CCGTGCTGTTGGAAGGAAGTGGG - Intronic
1191614989 X:63161064-63161086 TTGTTCTTATGGGAAGAAATTGG + Intergenic
1191621307 X:63217859-63217881 TTGTTCTTATGGGAAGAAATTGG - Intergenic
1196097621 X:111816791-111816813 CCATTGTTATGGAAGGAAGGTGG + Intronic
1196181531 X:112696815-112696837 CTGTACTTATAGAATGAATTTGG + Intergenic
1197040294 X:121928835-121928857 CTGTTCTTATGACAGTGAGTGGG + Intergenic
1197407999 X:126077725-126077747 CTGGTATTATGTAAGGACGTAGG - Intergenic
1198380321 X:136077628-136077650 CAGTTCTTAGAGAGGGAAGTGGG - Intergenic
1199124352 X:144097398-144097420 CTATTCTTAGGAAAGGAATTTGG - Intergenic
1199584104 X:149395091-149395113 CTGTTCTCATGATAGTAAGTGGG + Intergenic
1199782110 X:151071132-151071154 ATTTTCTTTTGGAAGCAAGTAGG + Intergenic
1201304588 Y:12539788-12539810 CTGTTCTTATAGAAGATGGTGGG + Intergenic
1201477022 Y:14393487-14393509 TTGTTCTGATGGTAGGAAGTAGG + Intergenic