ID: 1003172457

View in Genome Browser
Species Human (GRCh38)
Location 6:3730616-3730638
Sequence CTGCTGTCCGTGGTTGAAAC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 69
Summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 61}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1003172457_1003172461 -10 Left 1003172457 6:3730616-3730638 CCCGTTTCAACCACGGACAGCAG 0: 1
1: 0
2: 1
3: 6
4: 61
Right 1003172461 6:3730629-3730651 CGGACAGCAGATATTTACATGGG 0: 1
1: 0
2: 0
3: 1
4: 61
1003172457_1003172466 26 Left 1003172457 6:3730616-3730638 CCCGTTTCAACCACGGACAGCAG 0: 1
1: 0
2: 1
3: 6
4: 61
Right 1003172466 6:3730665-3730687 GGTCAGTTTTCACAAGACGATGG 0: 1
1: 0
2: 0
3: 7
4: 67
1003172457_1003172462 5 Left 1003172457 6:3730616-3730638 CCCGTTTCAACCACGGACAGCAG 0: 1
1: 0
2: 1
3: 6
4: 61
Right 1003172462 6:3730644-3730666 TACATGGGAGTTGACCTCCCAGG 0: 1
1: 0
2: 0
3: 3
4: 84

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1003172457 Original CRISPR CTGCTGTCCGTGGTTGAAAC GGG (reversed) Intronic
900337815 1:2173402-2173424 CTGCTGTCCTTGGGCAAAACGGG + Intronic
904702874 1:32368532-32368554 CTGATGTCCGTGCTTGAGCCTGG + Exonic
904756496 1:32771265-32771287 CTGGCGTCAGTGGTAGAAACAGG - Exonic
909044451 1:70691905-70691927 CTGATGTCCGTGGCTCATACTGG + Intergenic
910312419 1:85839191-85839213 CTGCTGTTGTTGTTTGAAACAGG - Intronic
910516439 1:88066498-88066520 CTGCTCTCTTTGGTTGGAACTGG - Intergenic
912627984 1:111222029-111222051 CTGCTGTGTGTGGGGGAAACTGG + Intronic
915529968 1:156497790-156497812 CTGCTCTCCCTGGTTGGCACTGG - Intronic
1063511775 10:6652092-6652114 ATGCTATCCATGGTTAAAACTGG - Intergenic
1075093799 10:119458250-119458272 CTGCTGTCCCTGGTGGACAGAGG + Intronic
1077137589 11:1008912-1008934 CTCCTGTCTGTGGGTGACACTGG + Intronic
1084622734 11:70284482-70284504 CTGCAGTCAGTGGTAGAGACAGG + Intronic
1102471949 12:113164178-113164200 CTGCTGTCCCTGCTGGAAGCGGG + Exonic
1104149025 12:126064209-126064231 CTGCTGTCCAAGGTAGATACAGG + Intergenic
1104591141 12:130085509-130085531 CTGCTGTCTGTGGTTGCCAGAGG + Intergenic
1105887452 13:24653837-24653859 TTGGTGTCAGTGGTTGAAAGGGG - Intergenic
1122505536 14:102229515-102229537 CTGCAGTCCGTGCTTGGATCTGG - Exonic
1127833896 15:62774410-62774432 TTGCTGTCGGTGGTTTAAACAGG + Intronic
1127865310 15:63027912-63027934 CTTCTGTCCGTGGTTGAGCTTGG - Intergenic
1136481212 16:30543122-30543144 CTGCTGTAAGTGGTTGTAAAGGG + Intronic
1149143969 17:53467633-53467655 CTGCTGTTCAGGGTGGAAACAGG + Intergenic
1153911098 18:9707655-9707677 TCGCTGTCCGTGTCTGAAACGGG - Intergenic
1156242036 18:35264115-35264137 TTGCTGTCAGTGGTTGAGGCCGG - Exonic
1158198875 18:54918228-54918250 CTGCTGAACTTGGTTTAAACAGG - Intronic
1160537894 18:79604689-79604711 CTGCTGTCTGTTGCAGAAACTGG - Intergenic
932866867 2:75352715-75352737 ATGCTGTCAGTGGTAGATACAGG - Intergenic
940881286 2:158949351-158949373 CTGCTTTCCGTAGTCAAAACAGG - Intergenic
944082430 2:195803290-195803312 CTTCTGTGAGTGGTTCAAACTGG + Intronic
1176262513 20:64189773-64189795 CTGCTGGCCGTGGTTGTCAGTGG + Intronic
1177890256 21:26796051-26796073 CTGCTGTGCGTGGTTGGAGGGGG + Intergenic
1179577513 21:42317241-42317263 CTGCTGTCCATTGATGAACCTGG - Intergenic
1179978474 21:44884311-44884333 CTGCTGGCCGTGGTTGCAGTTGG - Intergenic
1180953140 22:19729788-19729810 CGGCTCTCCGTGGTTTAGACTGG + Intergenic
1181666394 22:24401318-24401340 CTGTTGTCCGTGGTGTAAACTGG + Intronic
1184752084 22:46492409-46492431 TTTCTGTCCCTGGTTGAAATTGG - Intronic
950486214 3:13275476-13275498 GTGCTGTCATTGGTTGTAACAGG - Intergenic
954752846 3:52823429-52823451 CTGCTGCCTGTGGATGACACAGG - Intronic
963112300 3:141697775-141697797 CTGCTGTAAGTGGTTGTAAAGGG + Intergenic
965172455 3:165283780-165283802 CTCCTGCCAGTGGTTGAAATAGG + Intergenic
969054478 4:4393069-4393091 CTGCTGTCCCTGGTTGAGGCAGG + Intronic
982095327 4:151916984-151917006 CTCCTGTCCGTGGCTGAATCAGG - Intergenic
987002854 5:13678139-13678161 CTGCTGTCCCTGAAAGAAACTGG + Intergenic
991697814 5:69289369-69289391 CTGTGGTCCGTGGTAGAACCAGG + Intronic
992482827 5:77168390-77168412 CTGCCGTCTGGGGATGAAACTGG + Intergenic
992742391 5:79786941-79786963 CTGCTTTCAGTGCATGAAACAGG - Intronic
1003172457 6:3730616-3730638 CTGCTGTCCGTGGTTGAAACGGG - Intronic
1003800518 6:9660137-9660159 CTGCTGTTGGTGGTTGACAAAGG + Intronic
1006376707 6:33675621-33675643 CTGCTGTCCGTGGTGGGTAAGGG - Intronic
1006897761 6:37481756-37481778 CTGCAGTCCCTGCTTGTAACAGG - Intronic
1009827029 6:68879776-68879798 CTGCCCTCCTTGGTTGGAACTGG - Intronic
1016319167 6:142823175-142823197 CTGCTGTCTGTGGGGGCAACTGG - Intronic
1016372192 6:143386698-143386720 CTGCTGTCCCTGCTTGGAACTGG - Intergenic
1024190688 7:47005016-47005038 CTGCTTTCTGTGGTTTAAATTGG - Intergenic
1033823427 7:145161081-145161103 CTTCTGGCCTGGGTTGAAACGGG - Intergenic
1034062809 7:148108544-148108566 CTGCTCCCCGTGGTTGGAACTGG + Intronic
1039665277 8:39519194-39519216 CATCTATCCATGGTTGAAACTGG + Intergenic
1043989031 8:86729847-86729869 CTGCTGTCCATGTGTGAAGCTGG - Intronic
1045190102 8:99873439-99873461 CTGCTGTCCAGGGCTGAAAGAGG + Intronic
1046644491 8:116770313-116770335 CTGCTTTCCATGGTTGAAGAGGG + Exonic
1046956234 8:120065554-120065576 CTTCAGTCCCTGGTTGAAATTGG - Intronic
1049394735 8:142394708-142394730 CTGCTGCCCCTGGTTGGAGCAGG - Intronic
1051143489 9:14003148-14003170 CTGGTGTCAGTGGTTGAAACTGG + Intergenic
1051294310 9:15578879-15578901 CTACGGTCCGAGGTTGAAAAGGG + Exonic
1053479364 9:38404575-38404597 CAGCTCTCGTTGGTTGAAACGGG + Intergenic
1055715471 9:79112858-79112880 CTGCTCTGGGAGGTTGAAACAGG + Intergenic
1056277727 9:85009486-85009508 CTGCTTTGCGATGTTGAAACTGG - Intronic
1060448434 9:123714206-123714228 CTGGTATCTGTGGCTGAAACAGG - Intronic
1186040216 X:5468212-5468234 CTGCAGCCCGTGGTTAAAATCGG - Intergenic
1196467623 X:115989451-115989473 TTGCTGTTGGTGGTTGAACCTGG + Intergenic