ID: 1003172736

View in Genome Browser
Species Human (GRCh38)
Location 6:3733007-3733029
Sequence AGAGCCTCAGCCTCCTGCAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 422
Summary {0: 1, 1: 0, 2: 7, 3: 37, 4: 377}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1003172736_1003172742 3 Left 1003172736 6:3733007-3733029 CCCCTGCAGGAGGCTGAGGCTCT 0: 1
1: 0
2: 7
3: 37
4: 377
Right 1003172742 6:3733033-3733055 GTGGAGGTGACAACATCAAAAGG 0: 1
1: 0
2: 1
3: 16
4: 155
1003172736_1003172745 18 Left 1003172736 6:3733007-3733029 CCCCTGCAGGAGGCTGAGGCTCT 0: 1
1: 0
2: 7
3: 37
4: 377
Right 1003172745 6:3733048-3733070 TCAAAAGGCTAGCGTGGGCTAGG 0: 1
1: 0
2: 1
3: 11
4: 155
1003172736_1003172743 12 Left 1003172736 6:3733007-3733029 CCCCTGCAGGAGGCTGAGGCTCT 0: 1
1: 0
2: 7
3: 37
4: 377
Right 1003172743 6:3733042-3733064 ACAACATCAAAAGGCTAGCGTGG No data
1003172736_1003172744 13 Left 1003172736 6:3733007-3733029 CCCCTGCAGGAGGCTGAGGCTCT 0: 1
1: 0
2: 7
3: 37
4: 377
Right 1003172744 6:3733043-3733065 CAACATCAAAAGGCTAGCGTGGG 0: 1
1: 0
2: 1
3: 4
4: 71

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1003172736 Original CRISPR AGAGCCTCAGCCTCCTGCAG GGG (reversed) Intronic
900011001 1:108363-108385 GTTGCCTCAGCCTCCTGAAGTGG - Intergenic
900027103 1:284927-284949 GTTGCCTCAGCCTCCTGAAGTGG - Intergenic
900127769 1:1075979-1076001 ATAGCCTCAGCCTCCCGCCACGG - Intergenic
900128305 1:1077625-1077647 ATAGCCTCAGCCTCCCCCAACGG - Intergenic
900128315 1:1077655-1077677 ATAGCCTCAGCCTCCCCCAACGG - Intergenic
900128325 1:1077685-1077707 ATAGCCTCAGCCTCCCCCAACGG - Intergenic
900128448 1:1078045-1078067 ATAGCCTCAGCCTCCCCCAACGG - Intergenic
900128458 1:1078075-1078097 ATAGCCTCAGCCTCCCCCAACGG - Intergenic
900435314 1:2628337-2628359 ACAGACACAGCCTCCCGCAGGGG + Intronic
900497705 1:2983554-2983576 AGACCCCCAGCCTCCTGCCCTGG - Intergenic
900938897 1:5784970-5784992 AGAGCCCCAGCCACTTTCAGGGG + Intergenic
900945995 1:5831771-5831793 AGAGCCCCAGGCCCTTGCAGAGG + Intergenic
900983358 1:6059076-6059098 AGAGACCCAGACTCCTGCACTGG + Intronic
901224975 1:7608084-7608106 AGAGCATGGGTCTCCTGCAGGGG - Intronic
901238200 1:7678766-7678788 TGAGCCTGAGCCCCTTGCAGGGG + Intronic
901608201 1:10475419-10475441 ACGGCCTCAGCCTCCTGGAGCGG + Intronic
901780820 1:11593452-11593474 AAAGCAACAGCCACCTGCAGAGG + Intergenic
901972917 1:12921857-12921879 AGAGCCTCAGCAGCCAGCAGAGG + Intronic
902012264 1:13279906-13279928 AGAGCCTCAGCAGCCAGCAGAGG - Intergenic
902369174 1:15994602-15994624 AGAGGTTCAGCATCCTGCACGGG + Intergenic
902509537 1:16958686-16958708 AGACCCTGGGCCTCCGGCAGAGG + Exonic
903126916 1:21254608-21254630 AGTGCCTCAGCCCCCTACCGTGG - Intronic
904012839 1:27399571-27399593 AGAGCCCCACCTTCCTGCTGGGG + Intergenic
904031956 1:27538800-27538822 AGAAACTCAGGCTGCTGCAGTGG - Intronic
904111607 1:28130530-28130552 TGAGCCTCAGTTTCCTACAGTGG - Intergenic
904433056 1:30477637-30477659 ACAGCCACAGCATCCAGCAGGGG + Intergenic
904634171 1:31866893-31866915 AGAAGCACAGCCTCCAGCAGAGG - Intergenic
905895399 1:41542634-41542656 AGAGCCACAGTATCCTGCAGAGG + Intronic
906196059 1:43931491-43931513 TGAGCCTCTGCTTGCTGCAGGGG - Intergenic
906199511 1:43950035-43950057 AGCGCCTCACAGTCCTGCAGCGG - Exonic
906688336 1:47777018-47777040 TCAGCCTTAGCCTCCTGCACGGG - Intronic
906705499 1:47892063-47892085 AGAAGCACAGCCTCCTGGAGTGG + Intronic
907369577 1:53992242-53992264 AACCCCTCAGTCTCCTGCAGGGG + Intergenic
907729246 1:57049924-57049946 AGTGGCTGAGTCTCCTGCAGGGG + Intronic
908523322 1:64965860-64965882 AGACCCTCAGCCTCCTTCCTGGG + Intronic
909254477 1:73401789-73401811 ATAGCATCAGCCTCCTGCTCAGG - Intergenic
909596520 1:77412558-77412580 ACAGTATCTGCCTCCTGCAGGGG - Intronic
910566335 1:88647259-88647281 AGCCCCACAACCTCCTGCAGAGG - Intergenic
911041680 1:93596050-93596072 AGAGCCTCTGCCTTCAGCAAAGG + Intronic
912415008 1:109502165-109502187 AAAGGCTCAGGCCCCTGCAGTGG - Intronic
912737400 1:112162052-112162074 AGAGCCACTGACTCCTGCAGTGG - Intergenic
913615856 1:120558806-120558828 GGAGCCTCGACATCCTGCAGAGG - Intergenic
914574422 1:148952096-148952118 GGAGCCTCGACATCCTGCAGAGG + Intronic
914916766 1:151823878-151823900 CAAGCCTCAGCCTCCTGAAGTGG + Intronic
915603783 1:156938439-156938461 AGAGCCTGGGCCACCTGAAGTGG - Exonic
919004484 1:191878510-191878532 ATAGCCTCTGCCTCCTGGGGAGG + Intergenic
919083222 1:192891261-192891283 AGAGCTTCAGAGACCTGCAGAGG - Intergenic
919765546 1:201124910-201124932 AGGGCCTCAGCCACCAGGAGGGG - Intronic
920960139 1:210656531-210656553 ATAGCCTTATGCTCCTGCAGGGG + Intronic
921622401 1:217340407-217340429 CCAGCCTCAGCCTCCTGAGGAGG + Intergenic
922259446 1:223924370-223924392 GTTGCCTCAGCCTCCTGAAGTGG - Intergenic
922321150 1:224488570-224488592 ACTGCCTCAGCCTCCTGAATAGG + Intronic
922434487 1:225590350-225590372 TGAGCCTCAGCCTCCTGAGTAGG - Intronic
922874459 1:228929057-228929079 AGAGCCCCAGCCTCTAGCAGTGG + Intergenic
923040511 1:230316971-230316993 AGAGTCTGAGCCTCCTCAAGAGG - Intergenic
923153868 1:231258672-231258694 AGAGCCACTGCCTCCAGCCGGGG - Intronic
924340627 1:243027116-243027138 GTTGCCTCAGCCTCCTGAAGTGG - Intergenic
1063133493 10:3197477-3197499 TGCGTCCCAGCCTCCTGCAGCGG + Intergenic
1063189764 10:3682394-3682416 ACAGCCTCAGCTGCCTCCAGTGG + Intergenic
1064318342 10:14278372-14278394 AGAGGCTCAGGCTCCGGCTGTGG + Intronic
1065803142 10:29370795-29370817 AAAGCCTTAGCTTCATGCAGTGG + Intergenic
1065906636 10:30259696-30259718 CCTGCCTCAGCCTCCTGCATAGG + Intergenic
1066394260 10:35003795-35003817 AGAGCCTCAGCATTCTTAAGTGG - Intergenic
1066735872 10:38478483-38478505 GTTGCCTCAGCCTCCTGAAGTGG + Intergenic
1066984664 10:42454445-42454467 ATAGCCTCAGCCTAGGGCAGCGG - Intergenic
1067282656 10:44884053-44884075 TGAGCATCAGGGTCCTGCAGGGG + Intergenic
1068028875 10:51683292-51683314 AGAGCCTCACTCCCTTGCAGAGG - Intronic
1068604867 10:58993612-58993634 TGAGCCTCAGACAGCTGCAGTGG + Intergenic
1069625390 10:69864793-69864815 ACTGCCTCAGCTTCCTGCTGAGG - Intronic
1069808107 10:71138554-71138576 AGAGCCCCGCCCTCCTGCTGTGG + Intergenic
1070125302 10:73616711-73616733 TGTGCCTCAGCCTCCTGAGGAGG - Intronic
1071827529 10:89340145-89340167 AGAGCATCAGAAGCCTGCAGTGG + Exonic
1072141117 10:92590082-92590104 TGTGCCTCAGCCTCCTGAATAGG - Intergenic
1072309686 10:94142405-94142427 ACAGCCTCAGCCTTCTGAATAGG - Intronic
1072782905 10:98262260-98262282 ACAGGCTCTGCCTCCTGCATAGG + Intronic
1073536472 10:104281120-104281142 AGAGCCTCTGGGTTCTGCAGGGG + Intronic
1075441179 10:122480401-122480423 AGTGCCCCAGGGTCCTGCAGGGG + Intronic
1076311984 10:129515074-129515096 CGCTCCTCAGCTTCCTGCAGTGG + Intronic
1076335666 10:129704843-129704865 AGAGACCCAGCCTCCAGCACAGG + Intronic
1076525434 10:131109722-131109744 CCACTCTCAGCCTCCTGCAGCGG + Intronic
1077144736 11:1039884-1039906 AGGGCCTCAGCCTCCTGTGAGGG - Intergenic
1077279215 11:1734529-1734551 ACAGCCTCAGCTGCCTGCATTGG - Exonic
1077698074 11:4413268-4413290 ATAGACTCAGCCTCGTACAGAGG - Intergenic
1078136620 11:8657351-8657373 GGAGCATCAGGCTCCTCCAGTGG - Intronic
1078852007 11:15172539-15172561 AGGGCCTCTGCATCCTTCAGTGG - Intronic
1078857179 11:15215652-15215674 AGATCCTCAGCATCCAGCTGAGG - Intronic
1080978610 11:37373773-37373795 TCAGTCTCAACCTCCTGCAGAGG - Intergenic
1081522829 11:43899301-43899323 CGGGCCTCTGCATCCTGCAGTGG + Intronic
1081993045 11:47347803-47347825 AGGGCCTCAGACTCCAGCACTGG + Intronic
1082085626 11:48047399-48047421 AGGGTCTCTGCCTGCTGCAGGGG + Intronic
1082823407 11:57560419-57560441 AGATCCTCCAGCTCCTGCAGGGG + Exonic
1083079635 11:60077255-60077277 AGAATCTCAGCTTCCTGCTGCGG + Intergenic
1083172042 11:60928845-60928867 AGAGTCACAGCCTCGTCCAGAGG - Exonic
1083864147 11:65444618-65444640 AGAGCCTGAGCCAACAGCAGTGG + Intergenic
1084480494 11:69417174-69417196 AGACCCTCAGCGACCTGCCGAGG - Intergenic
1084566390 11:69931191-69931213 AGAGGCTCAGCCACCTGCACTGG - Intergenic
1085234853 11:75006422-75006444 AGATCCTGAGTCACCTGCAGGGG + Exonic
1088755029 11:112878609-112878631 AGAGGGTCAGCCTGCTGAAGTGG - Intergenic
1089102920 11:115978991-115979013 AGAACCTCAGCATCCTTAAGAGG - Intergenic
1089792693 11:120956056-120956078 AGACCCTCAGCCTAGAGCAGTGG - Intronic
1090419304 11:126562975-126562997 AGCTCCACAGCCCCCTGCAGAGG - Intronic
1090423225 11:126589882-126589904 AGAGCCTCAGCCAGCAGCTGGGG - Intronic
1091280516 11:134379324-134379346 AGGGCCCCAGCCTACTGAAGAGG - Intronic
1091302240 11:134515054-134515076 AAAGGCTCACCCTCCTGCCGAGG - Intergenic
1092500218 12:9038147-9038169 CCAGCCTCAGCCTCCTGAATAGG - Intergenic
1092613664 12:10197038-10197060 AGAATCTCAGCCAGCTGCAGTGG + Intergenic
1093739534 12:22667431-22667453 AGATACACAGCCTCCTGGAGGGG - Intronic
1094247724 12:28320448-28320470 TAAGCCTCATCCTCATGCAGTGG + Intronic
1094826792 12:34275734-34275756 AGAGCCTGATTCTCCTGCATGGG + Intergenic
1096252130 12:50040160-50040182 AGGGCCTCAGCCTCTGGCGGTGG - Intergenic
1096688917 12:53307597-53307619 AGAGCCTCCACCCCCAGCAGGGG + Exonic
1096741585 12:53697464-53697486 AGGGCCTCAGCTTCCTTCTGCGG + Intergenic
1096850156 12:54430204-54430226 TGTGCCTCAGCCTCCTTAAGCGG - Intergenic
1097040696 12:56154328-56154350 AGAGTCCCTGCCTCCAGCAGGGG - Intronic
1097664954 12:62467476-62467498 AGTGCCTCAGCCCTCTCCAGTGG - Intronic
1098824448 12:75275891-75275913 AGAGCCTTGGCCTACTGCAAGGG + Intergenic
1102287984 12:111674900-111674922 AGAGCCTCAGGCACCACCAGTGG + Intronic
1102574747 12:113849269-113849291 AGATCCTCAGCCTGGTGCTGGGG + Intronic
1102655740 12:114480956-114480978 AGGACCTGAGGCTCCTGCAGCGG + Intergenic
1102684844 12:114716785-114716807 ACAGCCTCAGCCTCCTGCCTTGG + Intergenic
1102955858 12:117058629-117058651 CTTGCCTCAGCCTCCTGCATTGG - Intronic
1103129301 12:118452954-118452976 AGAGCCCCGGCCTCCTACAGTGG + Intergenic
1103482958 12:121263078-121263100 CCTGCCTCAGCCTCCTGAAGTGG + Intronic
1104242184 12:127000741-127000763 GCAGCCTCAGCCTCATGCTGAGG + Intergenic
1104644818 12:130489551-130489573 AGAGGCTCCGTCTCCTGTAGAGG + Intronic
1104994624 12:132645972-132645994 AGAGCCTGAGCCTCGTTGAGAGG - Intronic
1105277187 13:18943253-18943275 AGAACCCCAGCCTCCTCCTGGGG + Intergenic
1105898766 13:24739894-24739916 AGAGCTTCAGCATCCTGTTGGGG - Intergenic
1106111929 13:26785161-26785183 AGAGCCTGAGCCAGATGCAGTGG - Intergenic
1107721884 13:43258075-43258097 CTAGCCCCAGCCTCCAGCAGTGG + Intronic
1110073252 13:71206179-71206201 GAAGCCTCAGCCACCTGGAGAGG - Intergenic
1112603278 13:100878252-100878274 AGAGCCTCAGCTTCCTTCTCAGG + Intergenic
1113375250 13:109759317-109759339 TCAGCCTCAGCCTCCTGGGGTGG - Intronic
1113571582 13:111361923-111361945 ACTGCCTCAGCTTCCTGCTGTGG - Intergenic
1116904060 14:50388174-50388196 AAAACCTCAGCCAGCTGCAGTGG - Intronic
1117341711 14:54797698-54797720 AGAGCCCCAGGGGCCTGCAGAGG - Intergenic
1118435348 14:65765988-65766010 ACAGCCTCAACCTACTGCAAGGG - Intergenic
1118659176 14:67988656-67988678 AGTGCCTCTTCCTGCTGCAGTGG - Intronic
1121335147 14:93073355-93073377 AGCTCCTCAGCCTCCAGCACAGG + Intronic
1121513640 14:94534482-94534504 AGACCCTGAGACTCCTGCATAGG + Intergenic
1121715292 14:96069621-96069643 AAGGCTTCAGCCTCCTGCACTGG + Intronic
1121761891 14:96452759-96452781 AGTGCCTCAGCCTCCTGAGTAGG + Intronic
1122938876 14:104972419-104972441 AGAGGCCCAGCCTGCTGGAGTGG + Intronic
1123218144 14:106831397-106831419 AGAGGCTCAGCCACCACCAGGGG - Intergenic
1125095095 15:35841498-35841520 AGAGCTTCAGCCTCCAGGTGAGG + Intergenic
1125767547 15:42145600-42145622 CGGGCCTCAGCTTCCTGGAGTGG - Exonic
1126856925 15:52847711-52847733 ATAGTGTCAGCCTTCTGCAGAGG - Intergenic
1128227922 15:66015281-66015303 TGACCCTCACCCTCCTACAGTGG - Intronic
1128353952 15:66911421-66911443 AGAGCCTCAGCCTCCAGGCCTGG + Intergenic
1129217168 15:74107082-74107104 AGGGCCCTGGCCTCCTGCAGGGG + Intronic
1129303789 15:74643513-74643535 ACAGCCTCAGCCTCATGCAGTGG - Intronic
1129407510 15:75328985-75329007 AGAGCCCTGGCCCCCTGCAGGGG - Intergenic
1130880915 15:88055158-88055180 ATGGCCTCAGCCTTCTGCAGAGG + Intronic
1130914048 15:88290895-88290917 AGAGCCTGACCCCTCTGCAGTGG - Intergenic
1131235335 15:90692001-90692023 CCAGCCTCAGCCTGATGCAGAGG + Intergenic
1131535256 15:93232094-93232116 AGGACTCCAGCCTCCTGCAGTGG - Intergenic
1132515500 16:364020-364042 AGACCCTCAGGCACCTGGAGTGG - Intergenic
1132804456 16:1769176-1769198 GGAGCCCCTGCCTCCTCCAGGGG - Exonic
1134450559 16:14360805-14360827 AGAGCCTGAGCCGCCTGCCTGGG + Intergenic
1134677522 16:16101141-16101163 AGAGCCTCAGCCTCCCGAGTAGG + Intronic
1135322625 16:21507376-21507398 GGAGCCCCAGCCAGCTGCAGAGG - Intergenic
1136159843 16:28412512-28412534 AGTGCCTCAGCCTCCCAAAGTGG + Intergenic
1136203245 16:28702780-28702802 AGTGCCTCAGCCTCCCAAAGTGG - Intronic
1136334102 16:29600513-29600535 GGAGCCCCAGCCAGCTGCAGAGG - Intergenic
1136401604 16:30022133-30022155 CCTGCCTCAGCCTCCTGGAGTGG - Intronic
1138340137 16:56283778-56283800 AGAGCCTCAGCACCCAGCATGGG - Intronic
1138984807 16:62315368-62315390 ATCGCATCAGTCTCCTGCAGGGG + Intergenic
1139354152 16:66357349-66357371 AGAGCTTGACCTTCCTGCAGGGG - Intergenic
1139448912 16:67014957-67014979 GAAACTTCAGCCTCCTGCAGAGG - Intergenic
1139455202 16:67069100-67069122 TGAGCCTCAGCCTCCTGAGTAGG - Intronic
1139669335 16:68481368-68481390 AGAGACTCAGACTACGGCAGGGG - Intergenic
1141361234 16:83396926-83396948 AGAGCCTCAGCTTCCTCAACTGG - Intronic
1141445040 16:84052211-84052233 AGAGCCGCAGCCACCTGCTAGGG + Intergenic
1142034870 16:87856605-87856627 GGAGCCCCAGCCAGCTGCAGAGG - Intronic
1142453345 16:90198553-90198575 GTTGCCTCAGCCTCCTGAAGTGG + Intergenic
1143345496 17:6245951-6245973 AGGGCCTCTGCCGCCTGCAGTGG + Intergenic
1143659294 17:8314952-8314974 AGGCCCTCACCATCCTGCAGGGG - Exonic
1143697555 17:8631174-8631196 AGAGCGCCAGCCTCCTGCCGCGG - Intergenic
1143934474 17:10468354-10468376 AGAGCCTCAGGTTGTTGCAGGGG + Intronic
1145271206 17:21405786-21405808 AGAGCTCCCGCCACCTGCAGGGG - Intronic
1145309410 17:21693173-21693195 AGAGCTCCCGCCACCTGCAGGGG - Intronic
1146043670 17:29483322-29483344 CCTGCCTCAGCCTCCCGCAGTGG + Intronic
1146650361 17:34602624-34602646 GGAGCTGCAGCCTCCTGCAGGGG - Intronic
1146676073 17:34774692-34774714 AGAGCTCCAGCCACCTGGAGAGG + Intergenic
1147778881 17:42925105-42925127 TGAGCCTCAGCTTCCTGCTGGGG + Intergenic
1148135104 17:45287032-45287054 GGAGACTCATCCTCCTGCGGGGG + Exonic
1148324110 17:46773388-46773410 GGCGCCTCAGGCTCCTGCTGTGG - Intronic
1150497420 17:65618827-65618849 CCTGCCTCAGCCTCCTGAAGTGG - Intronic
1150608566 17:66714656-66714678 GGAGCCTCGCCATCCTGCAGTGG - Intronic
1151289993 17:73142812-73142834 AAAGCCTCAGGCTCCTCCTGAGG + Intergenic
1151515130 17:74588895-74588917 AGGGCCACAGCCTCGTGCATTGG + Intronic
1151735626 17:75938442-75938464 CTTGCCTCAGCCTCCTGCTGCGG - Intronic
1151801813 17:76383566-76383588 AGCCCCGCAGCCTCCCGCAGGGG + Intronic
1152732143 17:81977654-81977676 GGAGCCTCCGCCGCCTGCCGGGG - Exonic
1152785229 17:82244475-82244497 AGGGCCTCAGCTCCCTCCAGTGG - Exonic
1155134812 18:22980132-22980154 AGTGCCTCAGCCTCCTGAGTAGG - Intronic
1156864098 18:41869318-41869340 AGAGCTGAAGCCTCCTTCAGGGG + Intergenic
1157794467 18:50560822-50560844 AGAGCCCCAGCCTGCCGGAGAGG + Intronic
1158621988 18:59040941-59040963 AGAGCCTCCCCGTCCTCCAGGGG - Intergenic
1160098746 18:75901099-75901121 ACAGGGTCAGCCTCCAGCAGAGG + Intergenic
1160236430 18:77089536-77089558 AGAGCCTCCGCCTCAGGCAGGGG + Intronic
1160292871 18:77609795-77609817 AGAGCTTCAGAGACCTGCAGAGG + Intergenic
1160697085 19:489877-489899 AGAGCCGCAGCCTCCTGGCTGGG - Intronic
1160779511 19:871688-871710 AGAGCCACTGCCACCTGCAGGGG + Intronic
1160831405 19:1106344-1106366 GCAGCCTCAGCCCCTTGCAGGGG + Intronic
1161653499 19:5499027-5499049 AGGGATTCAGCCTCCTCCAGGGG - Intergenic
1161762278 19:6182973-6182995 GGAGGCTCAGCCTTCTCCAGTGG + Intronic
1162046042 19:8001076-8001098 AGAGCTTCAGCTTCCTCCACTGG + Intronic
1162680262 19:12335116-12335138 TGAGCCCCAGCCACCTGGAGTGG - Intergenic
1163471757 19:17501256-17501278 TGAGCCTCTGCCTCCAGGAGTGG + Exonic
1164530859 19:29047207-29047229 ACAGCCTCAGCCAGGTGCAGTGG - Intergenic
1165015214 19:32875592-32875614 AGAGGCTCAGCCTCCTGCTGTGG + Intergenic
1165172576 19:33904545-33904567 AGTCGCTCAACCTCCTGCAGAGG - Intergenic
1165177908 19:33943537-33943559 GGAGCCACACGCTCCTGCAGAGG - Intergenic
1165420907 19:35721414-35721436 TGAGCCTGAGCCTCGGGCAGTGG + Exonic
1166268417 19:41699362-41699384 TGGGCCTCAACCTCCCGCAGAGG + Intronic
1166626031 19:44356736-44356758 ACGGCCTCAGCCTCCTAGAGCGG + Intronic
1166768471 19:45266163-45266185 AAACCCTCAGCCTCCCTCAGTGG - Intronic
1166935330 19:46329198-46329220 AGAGCATCAGCATCCTGCGGAGG - Exonic
1166966649 19:46533244-46533266 AGAGCCCAGGCCTCCTGCGGTGG + Intronic
1167032115 19:46969614-46969636 AGAGCACTTGCCTCCTGCAGAGG + Intronic
1167706906 19:51086558-51086580 AGCCCCTCAGCCTCCTCCAGGGG - Intergenic
1168319214 19:55499328-55499350 AGAGCCGTAGCTTCCAGCAGAGG - Intronic
1168581460 19:57559106-57559128 AGAGGGTCAGACTCCTGCTGGGG + Intronic
1168655555 19:58125115-58125137 CCTGCCTCAGCCTCCTGAAGTGG + Intergenic
925106318 2:1295614-1295636 GGAGACTCAGCCTTCTACAGTGG - Intronic
925106330 2:1295682-1295704 GGAGACTCAGCCTTCTACAGTGG - Intronic
925106343 2:1295750-1295772 GGAGACTCAGCCTTCTACAGTGG - Intronic
925106407 2:1296090-1296112 GGAGACTCAGCCTTCTACAGTGG - Intronic
925118672 2:1401087-1401109 GGAGCCTCAGTCTCCTGGAGGGG - Intronic
925334377 2:3082786-3082808 AGAGCCTAAGCATCAGGCAGAGG - Intergenic
925586839 2:5473309-5473331 AGAGCCTTAGCAACTTGCAGAGG - Intergenic
926435355 2:12832010-12832032 AGAGTCTGAGCCTCCTGAAAGGG - Intergenic
927516404 2:23674370-23674392 AGGGCCCCAGCCTCATTCAGCGG + Intronic
927670373 2:25063787-25063809 AGACCCTCAGGCCCCTGGAGAGG - Intronic
928203645 2:29268505-29268527 AGAGCCCCAGGCCCCTGCATAGG + Intronic
929184179 2:39076161-39076183 CAAGCCTCAGCCTCCTAAAGTGG - Intronic
929898470 2:45981858-45981880 AGAGCTTTAGAGTCCTGCAGAGG - Intronic
931348358 2:61467394-61467416 CCTGCCTCAGCCTCCTGCCGAGG + Intronic
931757093 2:65384106-65384128 GAAGCCTCAGCCACCTGCAACGG + Intronic
932429456 2:71665405-71665427 AGACCCACAGCCTGCTGCTGTGG - Intronic
932708674 2:74046832-74046854 AGGGCCTCTGCCTCCTGGTGAGG + Exonic
933236401 2:79869807-79869829 AGGGCCTCTTCCACCTGCAGTGG - Exonic
936756383 2:115717780-115717802 AGACCCTCAGCATCCAGCAAGGG - Intronic
938271504 2:129976055-129976077 AGAGGCTCAGGAGCCTGCAGTGG - Intergenic
938547416 2:132347419-132347441 ACGGCCTCAGCCTCCTAGAGCGG - Intergenic
938994355 2:136661624-136661646 CCTGCCTCAGCCTCCTGAAGTGG + Intergenic
942305407 2:174602291-174602313 AGAATCACAGCCTCCTGCCGTGG + Intronic
942388258 2:175464417-175464439 AGAGCCTCATGCTGCCGCAGTGG + Intergenic
943228279 2:185209641-185209663 ACAGCCTATGCCTGCTGCAGGGG + Intergenic
944688639 2:202139940-202139962 AGAGGCTCAGCCAGGTGCAGTGG + Intronic
945514720 2:210748958-210748980 AGTGCCTCAGTCTTCTGTAGAGG - Intergenic
946402569 2:219476360-219476382 ACAGGCTGAGCCACCTGCAGGGG + Intronic
947180242 2:227405012-227405034 ACAGCCAGGGCCTCCTGCAGAGG + Intergenic
947721761 2:232373969-232373991 CCTGCCTCAGCCTCCTGCAGTGG - Intergenic
949084788 2:242143202-242143224 GTTGCCTCAGCCTCCTGAAGTGG + Intergenic
1169020100 20:2324524-2324546 AGAGCCACTGCCTACTGCAAGGG - Intronic
1169182591 20:3582978-3583000 TAAGCCTCCTCCTCCTGCAGAGG + Intronic
1171339896 20:24419642-24419664 AGAGCCACAGCCCACTGAAGAGG - Intergenic
1171876282 20:30580174-30580196 ACGGCCTCAGCCTCCTAGAGCGG - Intergenic
1172332034 20:34081952-34081974 AGGGCCTCAGCCTCCACCATGGG - Intronic
1172411267 20:34725074-34725096 AGAGCCTCAGCCACGTGCAGTGG - Intronic
1172693894 20:36808672-36808694 AGAGTCTGAGCCTCCAGCGGAGG - Exonic
1173913601 20:46689350-46689372 AGAGCCTCAGCCTCCGGGGCGGG + Exonic
1173966719 20:47118015-47118037 AGAGCTACAGGCTCCTGCAAGGG - Intronic
1176066981 20:63203026-63203048 AGAGGCTGAGCCACCTGCTGGGG + Exonic
1176281367 20:64315678-64315700 GTTGCCTCAGCCTCCTGAAGTGG + Intergenic
1176522752 21:7837173-7837195 AGAGCCTGAGTCCCATGCAGGGG - Intergenic
1176890600 21:14313500-14313522 AGAGCATCAGTCTCCAGCAGTGG + Intergenic
1178256503 21:31057415-31057437 AAGGCCTCATCCTCCTCCAGAGG + Intergenic
1178656772 21:34467185-34467207 AGAGCCTGAGTCCCATGCAGGGG - Intergenic
1178677436 21:34643090-34643112 AGATCCTCAGCCTCCTGAGCTGG + Intergenic
1179262982 21:39775018-39775040 TGAGGCTCAGCCTCCTCCTGGGG + Intronic
1179553389 21:42157444-42157466 AGTTCCTCAGCTTCCTGAAGGGG - Intergenic
1180181255 21:46119615-46119637 ACAGCCTCAGCCTGCGCCAGTGG - Intronic
1180678206 22:17603524-17603546 ACAGCCTCAGCCATGTGCAGTGG + Intronic
1180921292 22:19522900-19522922 AGAGCCCCAGCCTCCAGCCCTGG + Intergenic
1181464860 22:23105446-23105468 AGAGCCTGAGCCTGCTGCAGAGG + Intronic
1181514427 22:23402875-23402897 ATCCCCTCGGCCTCCTGCAGGGG - Intergenic
1181527806 22:23500192-23500214 AGAGCCTCACCAACCTGCAAAGG + Intergenic
1181893055 22:26081681-26081703 AGAGCCTCAACCTTCTGGAGGGG + Intergenic
1182421945 22:30252844-30252866 AGAGCCACAGCCTGCAGTAGAGG + Intergenic
1183463791 22:37968778-37968800 GGAGGCCCTGCCTCCTGCAGAGG - Exonic
1184367447 22:44061317-44061339 CCAGCCTCAGCCTCCTGAATAGG - Intronic
1184442713 22:44528000-44528022 GGAGCCTCAGCCGGGTGCAGTGG - Intergenic
1184491338 22:44810920-44810942 TGAGCCTGAGCCTCCTGAAAGGG - Intronic
950005746 3:9689955-9689977 AGTGGCTCTTCCTCCTGCAGTGG - Exonic
950468082 3:13167372-13167394 TGAGCCTCAGCTTCCCACAGTGG - Intergenic
950505072 3:13389444-13389466 TGAGCCTCAGCCTCCTGCCCTGG - Intronic
950614910 3:14150629-14150651 AGGAGCTCAGGCTCCTGCAGGGG + Intronic
951553059 3:23894789-23894811 ATAGCATCAGCTTTCTGCAGGGG - Intronic
952373797 3:32748143-32748165 AGAGCCATAGCCAACTGCAGTGG - Intronic
952910668 3:38182006-38182028 AGAGTCTCAGCCAGGTGCAGTGG - Intronic
953415059 3:42710956-42710978 AGAGCCTCAGCCGGGTGCGGTGG + Intronic
954377201 3:50201508-50201530 AGAGCCCCAGCAACATGCAGGGG + Intergenic
959935062 3:112020609-112020631 AGAGCCTCACTCTTCTGCACAGG - Intergenic
961378744 3:126483466-126483488 AACTCCTCTGCCTCCTGCAGGGG - Exonic
961782228 3:129326963-129326985 TGAGCCTCAGCCTCCTGCCCTGG - Intergenic
962753419 3:138451081-138451103 AGAGACTGAGACTCCTGGAGGGG + Intronic
965603060 3:170473521-170473543 AGTGCCTCAGCTATCTGCAGTGG - Intronic
967075608 3:185999426-185999448 CCAGCCTCAGCCTCCCGAAGTGG - Intergenic
967302288 3:188026739-188026761 TGAGCCTCAGCCTCAGGCACTGG - Intergenic
969239709 4:5890342-5890364 AGCCGCTCAGCCTCCGGCAGCGG + Intronic
969405657 4:6989758-6989780 AGAGCCCCAGTCTCATGCAGAGG - Intronic
969566544 4:7982088-7982110 AGTGGCTCAGTCTCCTGCTGGGG - Intronic
970552214 4:17193607-17193629 AGAGCCTAAGCAGCCTACAGAGG - Intergenic
972295060 4:37729560-37729582 AGAAACTCAGCCTACTTCAGGGG - Intergenic
972381626 4:38525109-38525131 AGAAGCTCACCCTCCTTCAGAGG - Intergenic
972544823 4:40070558-40070580 CCTGCCTCAGCCTCCTGGAGTGG + Intronic
974512979 4:62869063-62869085 AGGGCCTCAGTCCCCTGCTGTGG + Intergenic
976667258 4:87609337-87609359 AGAGCCTCAGCATACTGGAAAGG - Intronic
976679897 4:87745331-87745353 AGAGCTTCAGAGACCTGCAGAGG - Intergenic
976790153 4:88869400-88869422 TGGGCTTCAGCCTCCTGCAGTGG + Intronic
976889636 4:90031190-90031212 AGATCCTGAGCTTCCTGCAGAGG + Intergenic
978406595 4:108385589-108385611 AGAGCCTTAGCCGGGTGCAGTGG + Intergenic
979262225 4:118661443-118661465 GTTGCCTCAGCCTCCTGAAGTGG + Intergenic
981415817 4:144492218-144492240 AAAGCCTCAGCCTCCCAAAGTGG + Intergenic
981698321 4:147581306-147581328 AGACCCTCAGCCTTCCCCAGAGG + Intergenic
983149614 4:164261892-164261914 GTTGCCTCAGCCTCCTGAAGTGG - Intronic
983911829 4:173248267-173248289 AGAACCTGAGCCTCCTGGAGTGG + Exonic
984857520 4:184207722-184207744 AGGGCCCCAGCGTGCTGCAGAGG - Intronic
985790627 5:1925263-1925285 AGAGCCCCCGCCTCCCGCAGTGG - Intergenic
986169994 5:5307422-5307444 AGGCCCTCTGCCTGCTGCAGAGG + Intronic
986442884 5:7797123-7797145 CTAGCCTGACCCTCCTGCAGAGG - Intronic
988600870 5:32638464-32638486 ATATCCTCTGCCTCCTGCTGGGG + Intergenic
989119648 5:37991503-37991525 ATAGCCACAGGGTCCTGCAGGGG + Intergenic
989617079 5:43347897-43347919 ACAGCACCAGCATCCTGCAGAGG + Intergenic
990823759 5:59874089-59874111 ACTGCCTCAGCCTCCTGCGTAGG - Intronic
992015601 5:72572489-72572511 AGAGCCTCAGCCTGCTGCCTGGG + Intergenic
992693709 5:79263751-79263773 ACAGCATCAGCCTCCTGCTTTGG + Intronic
992749425 5:79848804-79848826 AGAGCCGAAGCTCCCTGCAGTGG + Intergenic
992911706 5:81401456-81401478 ACAGGCTCAGCCTCCTGCAGGGG - Intergenic
993095321 5:83473139-83473161 AGCGCCCCACCGTCCTGCAGAGG + Intronic
995133668 5:108657969-108657991 AGAGTCTCAGCCTGGTGCGGTGG + Intergenic
995988401 5:118208036-118208058 TGAGCCTCCCCCTCCTGCATTGG - Intergenic
996716508 5:126592174-126592196 CCCGCCTCAGCCTCCTGAAGTGG + Intronic
997303483 5:132823093-132823115 AGCGACTCCGGCTCCTGCAGCGG - Exonic
997613580 5:135231532-135231554 TGAGCCACACCCTCCTGCAGTGG - Intronic
997859808 5:137406118-137406140 AGAAGCCCAGCCTCCTACAGAGG + Intronic
998336613 5:141377357-141377379 CCTGCCTCAGCCTCCTGAAGAGG - Intronic
999693966 5:154171909-154171931 AGAGATACAGCCTCCTGCTGAGG - Intronic
1001484657 5:172111034-172111056 GGGCCCTCAGCCTCCTGAAGTGG + Intronic
1002075280 5:176704863-176704885 AGAGCCTCAGCCATGGGCAGGGG - Intergenic
1002159250 5:177305316-177305338 CGTGCCTCAGCCTTCTGAAGAGG + Intronic
1002163639 5:177331868-177331890 AGAGCCTCCGTCTCCAGCTGTGG + Exonic
1002189166 5:177469899-177469921 ACAGCCCCAGCCTCCTGCCTTGG - Intronic
1002303918 5:178272573-178272595 AGGGCCTCAGCCTCCATCACAGG + Intronic
1002549160 5:179974211-179974233 GGAGCCTCAGACATCTGCAGCGG + Intronic
1002689078 5:181037749-181037771 AGAGCTTCAGAGACCTGCAGAGG + Intergenic
1002719113 5:181247080-181247102 CGTGACTCAGCCTCCTCCAGCGG - Intronic
1002966920 6:1975900-1975922 GGAACCTCAGGCTTCTGCAGAGG - Intronic
1003172736 6:3733007-3733029 AGAGCCTCAGCCTCCTGCAGGGG - Intronic
1004251273 6:14024981-14025003 TGATCCTCAGCCTCCGGAAGAGG + Intergenic
1004280446 6:14275680-14275702 GGAGCATGAGCCTCCAGCAGAGG + Intergenic
1005634655 6:27741708-27741730 TCACGCTCAGCCTCCTGCAGAGG - Intergenic
1005873492 6:29994634-29994656 AGGGCCTCAGCCCCCTGCCCTGG - Intergenic
1006075491 6:31529693-31529715 AGGGCCTCAGCCCCCTGCCCTGG + Intronic
1006170063 6:32087395-32087417 GCGGCCTCAGCCGCCTGCAGAGG - Intronic
1006633099 6:35443372-35443394 AGACCCCCAGCCCCCTGGAGTGG + Intergenic
1006861819 6:37176723-37176745 CCTGCCTCAGCCTCCTGCATAGG - Intergenic
1011481320 6:87796620-87796642 AGAGCCTCAGGGCCCTGCAAGGG - Intergenic
1018643084 6:165922865-165922887 AGAGCCTAAGCCACCTTCCGGGG + Intronic
1019018364 6:168896822-168896844 AGAGCTTCAGGCTCCTGGGGAGG - Intergenic
1019373118 7:673901-673923 AGGGCCGCAGCCACCTGAAGAGG - Intronic
1019702029 7:2478689-2478711 AGAGCCTCTCCCTCCTGGGGCGG + Intergenic
1020002826 7:4765409-4765431 AGAGCCTCAGCCCCCAGCCTGGG + Exonic
1020098373 7:5380879-5380901 AGAGGCTCAGCCACCTGAGGGGG + Intronic
1022326324 7:29335317-29335339 AGAGACTGAGCCTCCAGCAAGGG - Intronic
1023221674 7:37925574-37925596 AGAGAATCAGCCTCCTGTAGTGG + Intronic
1023874268 7:44278248-44278270 AGACCCTCTGCGTCCTGCTGCGG - Intronic
1023918571 7:44608607-44608629 CCTGCCTCAGCCTCCTGCTGAGG - Intronic
1024703517 7:51930468-51930490 ATAGACTCAGCCTCCTTCAGTGG + Intergenic
1026171350 7:67956685-67956707 AGAGCCTCAGCCAGGCGCAGTGG + Intergenic
1026830579 7:73607609-73607631 TCAGCCTCAGGCCCCTGCAGGGG + Exonic
1029195584 7:98803053-98803075 AGAGGCTCAGCCAGGTGCAGTGG + Intergenic
1029634687 7:101776144-101776166 GGAGCCCCAGTCTCCTTCAGGGG - Intergenic
1029870044 7:103680908-103680930 AGAGTCTCAGCCTTCTGCAGAGG + Intronic
1032517611 7:132518744-132518766 ACAGGCTCAGCCTCCTGCAGAGG - Intronic
1033149549 7:138901435-138901457 CATGCCTCAGCCTCCTGAAGAGG + Intronic
1034879512 7:154752676-154752698 AGAGCTACAGCCTCCTGCGGTGG - Intronic
1035025157 7:155820271-155820293 GGAGCCTCAGCCTCCTCCTCTGG - Intergenic
1035277185 7:157754599-157754621 GGAGCCTCGGCCTCCTCCAAAGG - Intronic
1035633482 8:1126566-1126588 AGAGGCTTAGACTCCTGCTGTGG + Intergenic
1036730341 8:11257447-11257469 TGTGCCTCAGCCTCCTGAATAGG + Intergenic
1038159722 8:25025109-25025131 AGAGCATCCACCTCCTCCAGTGG - Intergenic
1038450095 8:27634148-27634170 ACAGCTCCAGCCGCCTGCAGCGG + Intronic
1038472618 8:27838033-27838055 AGAGCTTCAGCCTTCAGCACAGG - Exonic
1039530915 8:38261414-38261436 AGAACCTCAGCAGCCTGTAGAGG - Exonic
1040323386 8:46329457-46329479 AGAGCCCCAGGTTCCTGCTGAGG - Intergenic
1040619543 8:49075260-49075282 AGATCCTCTGCCTGCTGCAGTGG + Exonic
1040840523 8:51779922-51779944 AGAGCCTCAGCCTGGTGTGGTGG + Intronic
1042055313 8:64758071-64758093 AGAGCCTGAGCCTGAAGCAGAGG - Intronic
1044474658 8:92612180-92612202 GTTGCCTCTGCCTCCTGCAGGGG - Intergenic
1044726775 8:95200760-95200782 GGGGGTTCAGCCTCCTGCAGAGG - Intergenic
1048882827 8:138884239-138884261 AGAGTCCCAGCCCCCTGCTGAGG - Intronic
1049348884 8:142153549-142153571 AGAGCCTCAGCCTTCTGGCTAGG + Intergenic
1049365185 8:142233640-142233662 AGGGGCTCAGCCTCCTGAGGAGG - Intronic
1049636963 8:143694316-143694338 AGAACCTCAGCCACCACCAGAGG + Exonic
1049742628 8:144248428-144248450 AGAGACTGTGTCTCCTGCAGAGG + Intronic
1052735928 9:32342476-32342498 AGAACCTCTGCCCTCTGCAGGGG - Intergenic
1053140654 9:35680616-35680638 AGTGCCTCAGTCTCCAGAAGAGG - Intronic
1053520887 9:38778188-38778210 CCTGCCTCAGCCTCCTGTAGCGG - Intergenic
1053536967 9:38935823-38935845 TTAACCTCAGCCTCCTGCTGTGG - Intergenic
1054629169 9:67428107-67428129 TTAACCTCAGCCTCCTGCTGTGG + Intergenic
1055980687 9:81997117-81997139 CCTGCCTCAGCCTCCTGCATAGG + Intergenic
1057962448 9:99469678-99469700 AGAGACTCAGCTTCCTTCAAGGG + Intergenic
1059677653 9:116555229-116555251 AGGCCCTCAGCCTCTTGCTGGGG - Intronic
1059707525 9:116838778-116838800 TGAGCCTCAGTCTCCTTCAATGG + Intronic
1061362346 9:130151654-130151676 CCTGCCTCAGCCTCCTGAAGTGG + Intergenic
1061404362 9:130385328-130385350 TGAGCCTCAGCCTCCTAGATGGG - Intronic
1062046929 9:134428630-134428652 AGAGCCGCAGCCTCTTTCGGGGG - Intronic
1062658158 9:137614700-137614722 TCAGCCTCAGCCTCCTCCTGGGG - Exonic
1185601112 X:1339894-1339916 AGGACCTCAGCCTCCTGCACTGG - Intronic
1186320667 X:8421004-8421026 AGAGCTCCAGCCTCCTGAATGGG + Intergenic
1189680351 X:43509525-43509547 ATGGCCTCAGCCACATGCAGAGG - Intergenic
1192890833 X:75389225-75389247 AGAGCCTCAGCTTGCAGTAGCGG - Intronic
1195934871 X:110115407-110115429 AGTGCCTCAACCTTCTGCAAAGG + Intronic
1198312619 X:135436606-135436628 AGATCCTGCGCCTCCGGCAGAGG + Intergenic
1199038252 X:143078922-143078944 AGAGGAACAGCCTCCTGGAGTGG + Intergenic
1199903965 X:152206260-152206282 GCAGCCTCAGCCTCCTCCTGGGG + Intronic
1202384300 Y:24309936-24309958 GTTGCCTCAGCCTCCTGAAGTGG + Intergenic
1202486484 Y:25360186-25360208 GTTGCCTCAGCCTCCTGAAGTGG - Intergenic