ID: 1003175779

View in Genome Browser
Species Human (GRCh38)
Location 6:3751583-3751605
Sequence CGCAGGAGGCGCGCCCCGGC CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 244
Summary {0: 1, 1: 0, 2: 1, 3: 23, 4: 219}

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1003175766_1003175779 -5 Left 1003175766 6:3751565-3751587 CCCCGCCGCCCGCCCGCCCGCAG 0: 1
1: 3
2: 30
3: 164
4: 986
Right 1003175779 6:3751583-3751605 CGCAGGAGGCGCGCCCCGGCCGG 0: 1
1: 0
2: 1
3: 23
4: 219
1003175761_1003175779 13 Left 1003175761 6:3751547-3751569 CCGCCAAGGGCTCCCCAGCCCCG 0: 1
1: 0
2: 6
3: 51
4: 451
Right 1003175779 6:3751583-3751605 CGCAGGAGGCGCGCCCCGGCCGG 0: 1
1: 0
2: 1
3: 23
4: 219
1003175764_1003175779 0 Left 1003175764 6:3751560-3751582 CCCAGCCCCGCCGCCCGCCCGCC 0: 1
1: 2
2: 33
3: 271
4: 1558
Right 1003175779 6:3751583-3751605 CGCAGGAGGCGCGCCCCGGCCGG 0: 1
1: 0
2: 1
3: 23
4: 219
1003175758_1003175779 16 Left 1003175758 6:3751544-3751566 CCCCCGCCAAGGGCTCCCCAGCC 0: 1
1: 0
2: 3
3: 39
4: 417
Right 1003175779 6:3751583-3751605 CGCAGGAGGCGCGCCCCGGCCGG 0: 1
1: 0
2: 1
3: 23
4: 219
1003175771_1003175779 -10 Left 1003175771 6:3751570-3751592 CCGCCCGCCCGCCCGCAGGAGGC 0: 1
1: 1
2: 1
3: 60
4: 405
Right 1003175779 6:3751583-3751605 CGCAGGAGGCGCGCCCCGGCCGG 0: 1
1: 0
2: 1
3: 23
4: 219
1003175769_1003175779 -7 Left 1003175769 6:3751567-3751589 CCGCCGCCCGCCCGCCCGCAGGA 0: 1
1: 2
2: 8
3: 109
4: 505
Right 1003175779 6:3751583-3751605 CGCAGGAGGCGCGCCCCGGCCGG 0: 1
1: 0
2: 1
3: 23
4: 219
1003175763_1003175779 1 Left 1003175763 6:3751559-3751581 CCCCAGCCCCGCCGCCCGCCCGC 0: 1
1: 2
2: 28
3: 280
4: 1784
Right 1003175779 6:3751583-3751605 CGCAGGAGGCGCGCCCCGGCCGG 0: 1
1: 0
2: 1
3: 23
4: 219
1003175759_1003175779 15 Left 1003175759 6:3751545-3751567 CCCCGCCAAGGGCTCCCCAGCCC 0: 1
1: 1
2: 0
3: 48
4: 404
Right 1003175779 6:3751583-3751605 CGCAGGAGGCGCGCCCCGGCCGG 0: 1
1: 0
2: 1
3: 23
4: 219
1003175760_1003175779 14 Left 1003175760 6:3751546-3751568 CCCGCCAAGGGCTCCCCAGCCCC 0: 1
1: 0
2: 5
3: 70
4: 693
Right 1003175779 6:3751583-3751605 CGCAGGAGGCGCGCCCCGGCCGG 0: 1
1: 0
2: 1
3: 23
4: 219
1003175767_1003175779 -6 Left 1003175767 6:3751566-3751588 CCCGCCGCCCGCCCGCCCGCAGG 0: 1
1: 3
2: 39
3: 124
4: 803
Right 1003175779 6:3751583-3751605 CGCAGGAGGCGCGCCCCGGCCGG 0: 1
1: 0
2: 1
3: 23
4: 219
1003175765_1003175779 -1 Left 1003175765 6:3751561-3751583 CCAGCCCCGCCGCCCGCCCGCCC 0: 1
1: 7
2: 110
3: 686
4: 3359
Right 1003175779 6:3751583-3751605 CGCAGGAGGCGCGCCCCGGCCGG 0: 1
1: 0
2: 1
3: 23
4: 219
1003175762_1003175779 10 Left 1003175762 6:3751550-3751572 CCAAGGGCTCCCCAGCCCCGCCG 0: 1
1: 1
2: 4
3: 66
4: 575
Right 1003175779 6:3751583-3751605 CGCAGGAGGCGCGCCCCGGCCGG 0: 1
1: 0
2: 1
3: 23
4: 219

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1003175779 Original CRISPR CGCAGGAGGCGCGCCCCGGC CGG Exonic
900237477 1:1599705-1599727 CGCACGCGGCGCGCGGCGGCCGG + Exonic
900412676 1:2520031-2520053 GGCAGGAGGCACGCGCGGGCAGG + Intronic
900466628 1:2828806-2828828 CGCAGGTGGCACGCTCCTGCTGG + Intergenic
900786911 1:4655177-4655199 CGGAGGATGTGCGCCCCCGCGGG + Exonic
900996128 1:6124576-6124598 CGCAGACGGCGTGCCCCGGGAGG - Exonic
901109546 1:6784668-6784690 CACAGGAGGCGGGCGCAGGCGGG + Intergenic
901595170 1:10379396-10379418 CGCAGCAGGGGCGCCCCAGAGGG - Intronic
902311504 1:15584902-15584924 GGCAGGACGCGCGCCCACGCCGG + Exonic
903385259 1:22921953-22921975 AGCAGGAGGCCCGCGACGGCAGG + Intergenic
904246973 1:29194675-29194697 CGCAGGAGGCAGGCCCAGGAAGG - Intronic
904542047 1:31239760-31239782 CAAAGGAGGCGCGGCTCGGCGGG - Intergenic
905995891 1:42380566-42380588 CGGAGGAGGGCAGCCCCGGCAGG - Intergenic
906636984 1:47416411-47416433 CGCAGGAGCCGAGCCAGGGCGGG + Exonic
906805645 1:48776838-48776860 CGCCGGGGGCGGGCCCCGGTCGG + Exonic
910757236 1:90706647-90706669 CGGAGCCGGCGCGCCGCGGCTGG + Intergenic
912430330 1:109625349-109625371 GGCAGGGGGCGGGGCCCGGCAGG - Exonic
915326304 1:155082743-155082765 CGCAGGAGGCGCGGCCCTAGAGG + Intronic
919486921 1:198157319-198157341 CGCAGGCGGCCCCTCCCGGCAGG - Intronic
919726950 1:200890975-200890997 AGCAGGAGGCGCTCGCCGGGAGG + Intergenic
920022676 1:202967332-202967354 GGCAGGAGGCGGGGCCTGGCGGG + Intergenic
920222151 1:204411821-204411843 CGCAGGGCCCGCGCGCCGGCAGG + Intergenic
921155017 1:212432800-212432822 CGCAGGAGGCGCGCGAAGGGCGG + Intergenic
922196437 1:223364001-223364023 CCGAGGAGGCGCGCGCAGGCCGG - Exonic
923055973 1:230426127-230426149 CGCAGGCTGCGGGCCGCGGCGGG + Intergenic
923551795 1:234970109-234970131 CGCAGGGGGCGGACGCCGGCGGG + Intergenic
1063745395 10:8874114-8874136 GGCAGGAGGCGTTCCCAGGCTGG - Intergenic
1064410106 10:15097433-15097455 GGCAGGAGGCCAGCCCCGGGGGG + Exonic
1064712289 10:18140274-18140296 CGCGGGAGGCGCGCGCCGCGTGG - Intergenic
1067559943 10:47298315-47298337 CGCAGGAGGCCCGCACAAGCTGG - Intergenic
1069588931 10:69630219-69630241 CACAGGAAGCGCGCGCCGGAGGG - Intergenic
1070570429 10:77636850-77636872 GCCAGGAGCCGAGCCCCGGCAGG + Intronic
1071997786 10:91163757-91163779 GGCAGGAGGCAGGACCCGGCGGG + Intronic
1072070265 10:91908701-91908723 CACTGGTGGCGCGCCCCGTCCGG + Exonic
1073216571 10:101839932-101839954 CGCGGGAGGGCCGGCCCGGCAGG + Intronic
1073867178 10:107818384-107818406 CGCAGGAGGCGGGACACGTCTGG - Intergenic
1074546362 10:114404615-114404637 CGCTGGGGGCGAGCCCTGGCGGG - Intronic
1075054494 10:119207483-119207505 GGCAGGAGGCGCGCCTGGGCCGG + Intergenic
1077227593 11:1445158-1445180 CGCAGGAGGCCTCCCCGGGCTGG + Intronic
1077582090 11:3423153-3423175 CTCAGGAGGCGGGCCCTGGGAGG + Intergenic
1078594624 11:12675104-12675126 CGCGGGGGGCGCGGCGCGGCCGG - Intronic
1080418647 11:32091644-32091666 CGCCGCCGCCGCGCCCCGGCCGG + Intronic
1083227688 11:61295058-61295080 CGCAGGAGCCGAGCCCAGCCCGG - Exonic
1084239008 11:67805970-67805992 CTCAGGAGGCGGGCCCTGGGAGG + Intergenic
1084394599 11:68900929-68900951 AGCAGGAGGCGGGGCCCAGCAGG - Intronic
1084797490 11:71518587-71518609 CGCAGGAGGCGCCGCCAAGCAGG - Intronic
1084833424 11:71786870-71786892 CTCAGGAGGCGGGCCCTGGGAGG - Intergenic
1085332915 11:75668067-75668089 AGCCGGCGGCGGGCCCCGGCCGG - Exonic
1085395820 11:76206629-76206651 CGCGGGACGCGTCCCCCGGCCGG - Intronic
1088647302 11:111927183-111927205 TGCAGGAGGCGGGATCCGGCGGG + Exonic
1091302940 11:134519231-134519253 CGCAGGATGCACACCCCGTCAGG - Intergenic
1092409696 12:8243599-8243621 CTCAGGAGGCGGGCCCTGGGAGG + Intergenic
1094108112 12:26833962-26833984 CGCAGGAGGCGCGGCCTCGGAGG - Intergenic
1094125042 12:27014474-27014496 GGCAGGAGGCGCGCGCTGCCTGG - Intergenic
1094199131 12:27779822-27779844 CGGAGCCGGCGCGCCCCGGGCGG + Intergenic
1094460811 12:30695511-30695533 CGCCGAAGGGGCGCCCCTGCCGG - Intronic
1096221128 12:49828573-49828595 CGGAAGCGGCGCGCGCCGGCCGG - Intronic
1096495449 12:52037135-52037157 CGGGGGAGGCGCGCCGGGGCTGG + Intronic
1097794056 12:63843967-63843989 CGCGGGAGCCGCGCCCCCGGCGG - Intergenic
1097981713 12:65742446-65742468 GGCCGGGGGCGCTCCCCGGCGGG + Intergenic
1101679950 12:106955591-106955613 CGGAGGAGGGGCGCGCAGGCCGG + Intergenic
1102056520 12:109900476-109900498 CGCAGGCGGCCCGCGCGGGCGGG + Intronic
1102171662 12:110847119-110847141 CGCAGCAGGCGCGGCCGGGCGGG - Intronic
1102278277 12:111599158-111599180 GGCCGGAGGGGCGCCCGGGCTGG + Exonic
1103074308 12:117969447-117969469 CTCAGCAGGTGCGCTCCGGCTGG + Intergenic
1103410933 12:120710829-120710851 AGCGGGAAGCGCGGCCCGGCCGG - Intronic
1104030975 12:125065589-125065611 CCAAGGAGGAGCGCCCCGGTCGG + Exonic
1104039577 12:125121146-125121168 CGCAGGAGGCTCTCTCAGGCGGG - Intronic
1104905362 12:132210520-132210542 GGCAGGAGGTGCGCCCTGGCTGG + Intronic
1104961463 12:132490280-132490302 CGCATGGGGCGCGCCCCCGGGGG + Exonic
1105378025 13:19863093-19863115 CGAGGGAGGGGCGCCCCGGCCGG - Intronic
1105389237 13:19959261-19959283 CGGGGGAGGGGCGCCCCGGCTGG + Intronic
1105578056 13:21671099-21671121 CGCAGGAGGAGCGCTCCGCCCGG + Intergenic
1106602570 13:31200264-31200286 GGCGGGACGCGCGCGCCGGCGGG - Intronic
1111232601 13:85363256-85363278 CCCAGCAGGCGCCCGCCGGCCGG - Intergenic
1113801933 13:113091235-113091257 GGCAGGAAGCGCGGCCCAGCTGG + Intronic
1113805802 13:113109632-113109654 CGCAGGAGGCGCGTTCCGGAGGG - Intronic
1115119872 14:29927185-29927207 CGCAGGGGGCGCTGCCCGGCTGG - Intronic
1122905699 14:104800601-104800623 TGCGGGCAGCGCGCCCCGGCGGG - Intronic
1126348042 15:47717341-47717363 GGCAGGAGGCGCGGCCGGCCGGG - Intronic
1128124793 15:65184712-65184734 GGCAGGCGGCGGTCCCCGGCAGG + Intronic
1129199884 15:73992367-73992389 CGGCGGAAGCGGGCCCCGGCCGG - Intronic
1129790982 15:78340508-78340530 TGCAGAGGGCGCGCCCCGACGGG + Intronic
1131290202 15:91100400-91100422 CGCGGGGTCCGCGCCCCGGCTGG - Intronic
1132749836 16:1452477-1452499 CGCCTGAGGCTCGCCCCGTCAGG + Intronic
1132805766 16:1774402-1774424 CGGAGCAGGCGCCTCCCGGCTGG - Intronic
1132907432 16:2290053-2290075 GGCAGGAGGCACCCCCCGGCTGG + Intronic
1133350669 16:5098382-5098404 CTCAGGAGGCGGGCCCTGGGAGG + Intergenic
1134134188 16:11668666-11668688 CGGGGGAGGGGCGGCCCGGCGGG + Intronic
1135570361 16:23544660-23544682 CCCAGCAGGACCGCCCCGGCGGG + Exonic
1137300274 16:47143042-47143064 CGCAGCAGGTGGGACCCGGCTGG + Intronic
1139528082 16:67528753-67528775 CGCAGGGGGTGGGGCCCGGCGGG + Intronic
1141981005 16:87550569-87550591 AGCAGGTGGCGCGCCCGGGCAGG + Intergenic
1142429750 16:90019575-90019597 AGCAGGGGGCGCGCGCGGGCCGG - Intronic
1142498766 17:320869-320891 AGCAGGAGCCGCTCCCCGCCTGG - Intronic
1142520801 17:503251-503273 CCCAGGAAGCCCGCACCGGCGGG - Intergenic
1143581897 17:7832655-7832677 CACAGGAGGCCGGGCCCGGCTGG - Exonic
1146787302 17:35731650-35731672 AGCAGGCGGCGCGCTCCGGAGGG + Exonic
1147200806 17:38799848-38799870 CGCGGGAGGGGCTCCCCGCCCGG + Exonic
1151559228 17:74861752-74861774 CGGAGGTGGCGGGCCCCGGCGGG - Intergenic
1152729165 17:81961386-81961408 CGCCGGAGGCGCTCCCGGCCCGG + Intronic
1152742037 17:82022666-82022688 CGCGGGGCGCGCGGCCCGGCCGG + Intronic
1153900754 18:9614886-9614908 CGCGGGAGGCCCCGCCCGGCCGG - Intronic
1155392203 18:25349891-25349913 CGGAGGAGGGGCGCGCGGGCAGG - Intronic
1160362717 18:78297392-78297414 CCCAGGAGGGGCACCCCGACAGG - Intergenic
1160943194 19:1629577-1629599 CACTGGGGGCTCGCCCCGGCAGG - Intronic
1160972306 19:1775064-1775086 GGCAGGAGGCGCACGCCGCCCGG - Intronic
1161175826 19:2841718-2841740 CGCGGGAGGCGGGGCCGGGCGGG - Intronic
1161487525 19:4543915-4543937 CGTGGGAGGCGCGGCCGGGCCGG + Exonic
1163123498 19:15232043-15232065 CGCAGCAGCCGCGCCGGGGCCGG + Exonic
1164137651 19:22428379-22428401 CGGAGGAGGGGCGGCCCTGCAGG - Intronic
1164179630 19:22807453-22807475 CGGAGGAGGGGCGGCCCTGCAGG - Intergenic
1164431972 19:28196754-28196776 CCCAGGAGGATGGCCCCGGCAGG + Intergenic
1167743911 19:51340116-51340138 AGCAGGAGGCGCGACCCCGCGGG + Exonic
1168218616 19:54944533-54944555 CTCAGGAGACCCGCGCCGGCCGG - Intronic
926210075 2:10862911-10862933 TGCAGGAGGCGCTGCCTGGCGGG + Intergenic
927863242 2:26573522-26573544 CCCAGGAGTGGCGCCCAGGCCGG + Intronic
927948271 2:27150315-27150337 CGCAGGAAGGGCGGCCAGGCAGG - Exonic
929501165 2:42493070-42493092 GCGACGAGGCGCGCCCCGGCGGG - Exonic
932635705 2:73386104-73386126 GGCTGCAGGCGCACCCCGGCAGG + Exonic
932655908 2:73611007-73611029 CTGAGGAGGTGCGCCCTGGCTGG - Intergenic
934500548 2:94857485-94857507 CCCTGGCGGCGCGCGCCGGCAGG + Intergenic
934636287 2:95992355-95992377 TGCAGGAGGCGCGCACCCTCCGG - Intergenic
934797356 2:97113071-97113093 TGCAGGAGGCGCGCACCCTCCGG + Intergenic
934836049 2:97590368-97590390 TGCAGGAGGCGCGCACCCTCCGG - Intergenic
934993513 2:98937092-98937114 CGCGGGAGTCGCGTCCCAGCAGG + Intergenic
936153912 2:110036118-110036140 CGGAGGAGGAGGGCCCAGGCTGG + Intergenic
936190773 2:110335297-110335319 CGGAGGAGGAGGGCCCAGGCTGG - Intergenic
937369078 2:121285268-121285290 CCCAGGAAGCGCGGCCCGGAGGG + Intergenic
937956171 2:127422851-127422873 CGGAGGGGGCGCGCCCGGGTGGG - Intronic
938262762 2:129907051-129907073 CGCAGGAGGGGCCCGCAGGCTGG + Intergenic
938639766 2:133266468-133266490 CGCAGGGGGCGCGCCTGGGCGGG + Intronic
940883316 2:158968509-158968531 CGCGGGAGGCGCGGCCGGGGCGG + Intergenic
942278124 2:174337046-174337068 CGCCGCAGGCTCGCCCCGGCCGG - Exonic
942890263 2:180980280-180980302 CCCCGGAGGCGGGCCCAGGCCGG + Intronic
946397154 2:219448869-219448891 CCCAGGAGCCGCGGGCCGGCGGG + Exonic
948467422 2:238159026-238159048 AGCAGCAGGCGGGCTCCGGCGGG - Exonic
1170656027 20:18288547-18288569 CGCTGGAGGAGCTCCCCAGCTGG + Exonic
1171234071 20:23510159-23510181 CACAGCAGGCTCGCCCCAGCGGG + Intergenic
1171891772 20:30724187-30724209 CCCTGGAGGCGCGCGCCGGCAGG + Intergenic
1172284668 20:33732209-33732231 CGCGGGAGCCGAGGCCCGGCGGG + Intronic
1173853237 20:46232235-46232257 CCCAGGAGGAGCCCCCCAGCTGG + Intronic
1174343879 20:49915438-49915460 CGCCGGAGCCGGGCCCCGTCGGG + Intronic
1176549286 21:8214470-8214492 CGGAGGGGGCGGGCTCCGGCGGG + Intergenic
1176557179 21:8258693-8258715 CGGAGGGGGCGGGCTCCGGCGGG + Intergenic
1176568218 21:8397508-8397530 CGGAGGGGGCGGGCTCCGGCGGG + Intergenic
1176576121 21:8441728-8441750 CGGAGGGGGCGGGCTCCGGCGGG + Intergenic
1177905176 21:26965764-26965786 CGCAGCTGGCGCGCGGCGGCAGG + Exonic
1178493807 21:33070787-33070809 AGCAGCAGGCGCGGCGCGGCGGG - Exonic
1180188184 21:46150737-46150759 CACCGGAGGCCCACCCCGGCAGG + Intronic
1180762316 22:18219928-18219950 CGCAGGAGGCGGGCGGAGGCCGG + Intergenic
1180773351 22:18404680-18404702 CGCAGGAGGCGGGCGGAGGCCGG - Intergenic
1180804704 22:18654229-18654251 CGCAGGAGGCGGGCGGAGGCCGG - Intergenic
1180806042 22:18715181-18715203 CGCAGGAGGCGGGCGGAGGCCGG + Intergenic
1180837248 22:18936093-18936115 CGCAGGAGGCGTACCGCAGCCGG - Exonic
1181192447 22:21151613-21151635 CGCAGGAGGCGGGCGGAGGCCGG - Intergenic
1181216992 22:21340962-21340984 CGCAGGAGGCGGGCGGAGGCCGG + Intergenic
1184845738 22:47084465-47084487 TGCAGGAGGCGGGGCCCAGCAGG + Intronic
1185313938 22:50170704-50170726 GGCGGGGGGCGCGGCCCGGCGGG - Intergenic
1203235181 22_KI270731v1_random:145662-145684 CGCAGGAGGCGGGCGGAGGCCGG - Intergenic
1203254171 22_KI270733v1_random:130786-130808 CGGAGGGGGCGGGCTCCGGCGGG + Intergenic
1203262227 22_KI270733v1_random:175865-175887 CGGAGGGGGCGGGCTCCGGCGGG + Intergenic
1203287341 22_KI270734v1_random:161392-161414 CGCAGGAGGCGTACCGCAGCCGG - Intergenic
950426527 3:12927518-12927540 GGCAGAAGGCGGGACCCGGCTGG - Intronic
950743137 3:15065323-15065345 CACAGGAGACGCTTCCCGGCGGG + Exonic
952416727 3:33096806-33096828 GGAAGGACGCGCGCCCCGCCCGG + Intronic
954610399 3:51941975-51941997 AGTAGGAGGCGGGGCCCGGCGGG - Intergenic
954763877 3:52897213-52897235 CGCAGGAGGGGCCCCCAGGGGGG + Intronic
954796124 3:53161990-53162012 GGCGGGAGGCGAGGCCCGGCGGG - Intronic
954812406 3:53256136-53256158 GGCAGGAGGCGGCCCCAGGCGGG - Intergenic
956710490 3:72034926-72034948 CGCAGGAGGCTGACCCCTGCAGG + Intergenic
957048801 3:75396233-75396255 TGCAGGAGGCGCGCACCCTCTGG - Intergenic
957054935 3:75435729-75435751 CTCAGGAGGCGGGCCCTGGGAGG + Intergenic
961299903 3:125915945-125915967 CTCAGGAGGCGGGCCCTGGGAGG - Intergenic
961888607 3:130112128-130112150 CTCAGGAGGCGGGCCCTGGGAGG + Intronic
964569214 3:158094511-158094533 CGCGGGAGTCGGGCCGCGGCGGG - Intergenic
966721257 3:183064606-183064628 CGCAGGAGGCGTACCGCAGCCGG - Intronic
966886587 3:184380546-184380568 CGCAGGTGGCTCGGCGCGGCGGG + Intronic
966982838 3:185153553-185153575 GGCAGGAGGCCCGCCCTGGGTGG - Intergenic
967928461 3:194672137-194672159 GGCCGGAGGAGAGCCCCGGCCGG - Exonic
968997750 4:3956035-3956057 CTCAGGAGGCGGGCCCTGGGAGG + Intergenic
972394251 4:38644958-38644980 CACAGGAGGAGTGCCCAGGCAGG + Intergenic
972738466 4:41867287-41867309 TGCAGGAGCCGCGCCCCGGCAGG - Intergenic
978576721 4:110196790-110196812 CCCAGGAGGCGGGCTCCGCCCGG + Intronic
979205571 4:118033625-118033647 CGGCGGAGGCGCGGCCGGGCGGG + Intronic
980944128 4:139302164-139302186 GGCAGGAGTCGCGGCCCGGTTGG + Intronic
984260732 4:177441680-177441702 CACAGGAGGTGGGCCCCGGCAGG + Intronic
984795755 4:183658957-183658979 CTCAGGAGGCGCCCCGCGACCGG - Exonic
990041501 5:51383085-51383107 CGCAGGCGGCGCGGCCGGGAAGG + Intergenic
992105791 5:73448224-73448246 CGGCGGTGGCGGGCCCCGGCTGG - Exonic
992400045 5:76403504-76403526 CGCGGGGGGCGCGCCCCGGGCGG + Exonic
993901125 5:93584863-93584885 CGCAGGAGCCGAGCCCGAGCCGG - Exonic
999781997 5:154857563-154857585 AGGCGGAGGCGCGCCCCAGCTGG + Intronic
1001529891 5:172454413-172454435 CGCTGGGGGCGCGCCGCCGCGGG + Exonic
1002180088 5:177426804-177426826 GGCCGGCGGCGCGGCCCGGCGGG + Intronic
1002424352 5:179166666-179166688 CGCAGGAGGAGGGACCCGGCGGG - Intronic
1003175643 6:3751059-3751081 CGCCGGGGGCGCCCCCAGGCTGG + Intronic
1003175779 6:3751583-3751605 CGCAGGAGGCGCGCCCCGGCCGG + Exonic
1004544977 6:16588960-16588982 AGCAGGAGGAGAGACCCGGCTGG - Intronic
1005912894 6:30326607-30326629 CGCTGGACTGGCGCCCCGGCCGG - Intronic
1013366373 6:109440995-109441017 CGCAGGCGGCGCGCACAGGTGGG - Exonic
1019563206 7:1667894-1667916 CGGGGGAGGGGCGACCCGGCCGG + Intergenic
1020137276 7:5594277-5594299 AGGTGGAGGCGCGCCCCGCCGGG - Intronic
1021451094 7:20784708-20784730 CGCCGCAAGCTCGCCCCGGCAGG + Exonic
1021740293 7:23680051-23680073 CGCAGGACGCGCGCCCCTACTGG - Intergenic
1022528464 7:31052870-31052892 CGCAGGAAGGGCGCAGCGGCGGG - Intronic
1023407854 7:39855061-39855083 CTCAGGAGGCGCCCCGCGACCGG - Intergenic
1025004728 7:55344904-55344926 CGCAGGCGCCGCGCCCCCGCGGG - Intergenic
1026822325 7:73557772-73557794 CTCAGGAGGGACGCCCCGGGCGG - Exonic
1027138245 7:75639317-75639339 CGGGGGAGGCGCGGCCCCGCCGG + Intronic
1027236638 7:76302432-76302454 CGCTGGAGCCGTGCCACGGCAGG - Intergenic
1027250786 7:76397590-76397612 CGAAGGCGGCGAGCCCCGCCTGG - Exonic
1027374696 7:77537752-77537774 CGGAGGGGGCGCGCACCAGCCGG + Intronic
1032344386 7:131106035-131106057 CGCCGGCCGCGCGCCCCGGCAGG + Intergenic
1033848401 7:145463311-145463333 AGCAGGAGGCTCCCACCGGCTGG + Intergenic
1035199114 7:157248796-157248818 CGCAGGAGGGGCTGCCGGGCAGG - Intronic
1035626547 8:1075355-1075377 CGCAGGAGGAGAACCGCGGCTGG + Intergenic
1036379495 8:8227925-8227947 CTCAGGAGGCGGGCCCTGGGAGG - Intergenic
1036561907 8:9905496-9905518 CGCAGGAGGCGAGCCGGCGCTGG + Intergenic
1036850064 8:12194688-12194710 CTCAGGAGGCGGGCCCTGGGAGG + Intergenic
1036871428 8:12436961-12436983 CTCAGGAGGCGGGCCCTGGGAGG + Intergenic
1037882364 8:22579380-22579402 TGGAGGAGGAGCGCTCCGGCCGG - Exonic
1042591502 8:70402787-70402809 TGCAGGAGGCGCGCTGGGGCCGG - Intronic
1046547447 8:115669139-115669161 CGCAGCCGGCTCGCCGCGGCCGG - Intronic
1049471882 8:142778572-142778594 AGCAGGAGGCGAGCGCTGGCGGG - Intergenic
1049642556 8:143722091-143722113 CTCCGGAGGCCCGGCCCGGCCGG + Exonic
1049659987 8:143815569-143815591 GGCAGGGGGCGCGGCCCGGCGGG + Intergenic
1053906977 9:42852285-42852307 CCCTGGCGGCGCGCGCCGGCAGG - Intergenic
1057773193 9:97984547-97984569 GGCCTGTGGCGCGCCCCGGCTGG - Intronic
1057786018 9:98087794-98087816 TGCAGGAGGCGGGCGCCGGCTGG - Exonic
1058070799 9:100598860-100598882 CGCAGTAAGCGCGCCGGGGCCGG + Intergenic
1060555013 9:124503630-124503652 CGCGGGAGGAGCCCCCCGGACGG - Intronic
1061299649 9:129697353-129697375 CCGAGGGTGCGCGCCCCGGCCGG - Intronic
1061559664 9:131394315-131394337 TGGAGGCGGCGCGGCCCGGCCGG + Intronic
1062031083 9:134362291-134362313 CGAAGGAGGGGCGACCAGGCAGG - Intronic
1203748580 Un_GL000218v1:58249-58271 CCCTGGTGGCGCGCGCCGGCAGG - Intergenic
1203470572 Un_GL000220v1:113930-113952 CGGAGGGGGCGGGCTCCGGCGGG + Intergenic
1203478393 Un_GL000220v1:157902-157924 CGGAGGGGGCGGGCTCCGGCGGG + Intergenic
1185462345 X:339252-339274 AGCAGGAGGCGCCCCATGGCCGG + Intronic
1185747407 X:2583981-2584003 CGCTGGGGGCGCCCCCCGCCTGG + Intergenic
1186350119 X:8731941-8731963 CGCAGCAGCCGCGCCGGGGCCGG + Exonic
1192147826 X:68693753-68693775 GGCAGGAGGCGAGCCCAGGAGGG - Intronic
1198451088 X:136767570-136767592 TGCCGGAGGCGCGCCCCGCTGGG + Intronic
1200231143 X:154444446-154444468 CGCGGGCGGCGCGCCGGGGCAGG + Intronic
1201161927 Y:11173219-11173241 CCCTGGTGGCGCGCGCCGGCAGG - Intergenic