ID: 1003175901

View in Genome Browser
Species Human (GRCh38)
Location 6:3751981-3752003
Sequence CCTCGCGGCCCCGGAGCCGC AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 245
Summary {0: 1, 1: 1, 2: 2, 3: 23, 4: 218}

Found 13 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1003175882_1003175901 24 Left 1003175882 6:3751934-3751956 CCGAGTCCCAAGCGCTCGCCCCC 0: 1
1: 0
2: 0
3: 8
4: 123
Right 1003175901 6:3751981-3752003 CCTCGCGGCCCCGGAGCCGCAGG 0: 1
1: 1
2: 2
3: 23
4: 218
1003175884_1003175901 17 Left 1003175884 6:3751941-3751963 CCAAGCGCTCGCCCCCGCCTCGC 0: 1
1: 0
2: 1
3: 30
4: 309
Right 1003175901 6:3751981-3752003 CCTCGCGGCCCCGGAGCCGCAGG 0: 1
1: 1
2: 2
3: 23
4: 218
1003175885_1003175901 6 Left 1003175885 6:3751952-3751974 CCCCCGCCTCGCGCCCCCCGCGC 0: 1
1: 0
2: 19
3: 182
4: 1096
Right 1003175901 6:3751981-3752003 CCTCGCGGCCCCGGAGCCGCAGG 0: 1
1: 1
2: 2
3: 23
4: 218
1003175883_1003175901 18 Left 1003175883 6:3751940-3751962 CCCAAGCGCTCGCCCCCGCCTCG 0: 1
1: 0
2: 1
3: 3
4: 113
Right 1003175901 6:3751981-3752003 CCTCGCGGCCCCGGAGCCGCAGG 0: 1
1: 1
2: 2
3: 23
4: 218
1003175893_1003175901 -9 Left 1003175893 6:3751967-3751989 CCCCGCGCCTCCTCCCTCGCGGC 0: 1
1: 0
2: 6
3: 35
4: 373
Right 1003175901 6:3751981-3752003 CCTCGCGGCCCCGGAGCCGCAGG 0: 1
1: 1
2: 2
3: 23
4: 218
1003175894_1003175901 -10 Left 1003175894 6:3751968-3751990 CCCGCGCCTCCTCCCTCGCGGCC 0: 1
1: 2
2: 2
3: 56
4: 752
Right 1003175901 6:3751981-3752003 CCTCGCGGCCCCGGAGCCGCAGG 0: 1
1: 1
2: 2
3: 23
4: 218
1003175886_1003175901 5 Left 1003175886 6:3751953-3751975 CCCCGCCTCGCGCCCCCCGCGCC 0: 1
1: 2
2: 28
3: 231
4: 1303
Right 1003175901 6:3751981-3752003 CCTCGCGGCCCCGGAGCCGCAGG 0: 1
1: 1
2: 2
3: 23
4: 218
1003175888_1003175901 3 Left 1003175888 6:3751955-3751977 CCGCCTCGCGCCCCCCGCGCCTC 0: 1
1: 0
2: 11
3: 86
4: 826
Right 1003175901 6:3751981-3752003 CCTCGCGGCCCCGGAGCCGCAGG 0: 1
1: 1
2: 2
3: 23
4: 218
1003175890_1003175901 -7 Left 1003175890 6:3751965-3751987 CCCCCCGCGCCTCCTCCCTCGCG 0: 1
1: 0
2: 6
3: 79
4: 753
Right 1003175901 6:3751981-3752003 CCTCGCGGCCCCGGAGCCGCAGG 0: 1
1: 1
2: 2
3: 23
4: 218
1003175887_1003175901 4 Left 1003175887 6:3751954-3751976 CCCGCCTCGCGCCCCCCGCGCCT 0: 1
1: 0
2: 16
3: 76
4: 644
Right 1003175901 6:3751981-3752003 CCTCGCGGCCCCGGAGCCGCAGG 0: 1
1: 1
2: 2
3: 23
4: 218
1003175891_1003175901 -8 Left 1003175891 6:3751966-3751988 CCCCCGCGCCTCCTCCCTCGCGG 0: 1
1: 0
2: 2
3: 44
4: 490
Right 1003175901 6:3751981-3752003 CCTCGCGGCCCCGGAGCCGCAGG 0: 1
1: 1
2: 2
3: 23
4: 218
1003175881_1003175901 29 Left 1003175881 6:3751929-3751951 CCGGGCCGAGTCCCAAGCGCTCG 0: 1
1: 0
2: 0
3: 5
4: 63
Right 1003175901 6:3751981-3752003 CCTCGCGGCCCCGGAGCCGCAGG 0: 1
1: 1
2: 2
3: 23
4: 218
1003175889_1003175901 0 Left 1003175889 6:3751958-3751980 CCTCGCGCCCCCCGCGCCTCCTC 0: 1
1: 1
2: 19
3: 121
4: 1014
Right 1003175901 6:3751981-3752003 CCTCGCGGCCCCGGAGCCGCAGG 0: 1
1: 1
2: 2
3: 23
4: 218

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1003175901 Original CRISPR CCTCGCGGCCCCGGAGCCGC AGG Exonic
900207775 1:1438942-1438964 CCCCGCGGCCAAGGAGCTGCTGG - Intronic
901049580 1:6419606-6419628 CCTCCCGGCCCAGCAGCGGCAGG + Exonic
901051740 1:6428910-6428932 CCTCCTGGCCCCAGAGCCCCTGG + Intronic
901633082 1:10657307-10657329 CCTCCAGGCCCCAGGGCCGCTGG + Intronic
901814864 1:11788252-11788274 CCTCGAGGCACCGGCGCTGCAGG - Exonic
902124923 1:14201440-14201462 CCTGGCTGCCCCGGAGCAGCTGG + Intergenic
902514127 1:16980688-16980710 CCCTCCAGCCCCGGAGCCGCTGG + Exonic
903830157 1:26169816-26169838 CCTGGCGGCGCTCGAGCCGCTGG + Intergenic
904339761 1:29827294-29827316 CCTCGCCTCCCCGGAATCGCTGG + Intergenic
906636945 1:47416274-47416296 CCGCGCGGCTCCGGGACCGCAGG - Exonic
907440302 1:54474771-54474793 CCTCACAGCCCCGCAGCGGCCGG - Intergenic
907458340 1:54590374-54590396 CCTCAGGGCCCCGGAGCTCCCGG - Intronic
914386265 1:147172612-147172634 CCTCGGCGCCCGGGACCCGCCGG + Intergenic
917105334 1:171485836-171485858 CCACGCGGCCCCCTAGCCTCCGG - Intronic
918015953 1:180632458-180632480 CCCCGCAGCCCCGCTGCCGCCGG + Intronic
920002320 1:202808236-202808258 CCTCGGGGGCCCGGGCCCGCTGG - Exonic
920250355 1:204618762-204618784 CCTCACGGACCGGGAGGCGCTGG + Exonic
920865306 1:209747634-209747656 ACTCGCTGCCCCGGGACCGCTGG + Intergenic
922200031 1:223393675-223393697 CCCCGCGGCCTCGCAGGCGCGGG + Exonic
922661168 1:227431737-227431759 CAGCGAGGCCCCGGAGCCCCAGG - Intergenic
1069738433 10:70672589-70672611 CCTCGCGCGCCCGGAGCCAGCGG + Intergenic
1074121556 10:110497621-110497643 CACCGCGGCCCCGGAGCGCCTGG + Intergenic
1076612809 10:131737009-131737031 CCCCCCGGCCCCCGAGCCTCGGG - Intergenic
1077107869 11:849761-849783 CCGCGCGGGGGCGGAGCCGCCGG + Intronic
1077360792 11:2139431-2139453 CCGCGCGGGCCCTGGGCCGCGGG - Intronic
1077476533 11:2792948-2792970 CCCCGCCCCCCGGGAGCCGCAGG + Intronic
1081528520 11:43942875-43942897 CCGCCCGGCCCCGCAGACGCCGG + Exonic
1081831986 11:46121726-46121748 CCGAGCGTCCCGGGAGCCGCGGG - Intergenic
1083457135 11:62786814-62786836 CCGGGCGGCCGCGGAGCCGTGGG - Exonic
1083594876 11:63914430-63914452 CCTTGCGGCCCCCCAGCCGCCGG + Exonic
1083596258 11:63919426-63919448 CCCCGCAGCCCCGGGGCGGCAGG - Intergenic
1083648265 11:64185643-64185665 CCCAGAGGCCCCGCAGCCGCCGG + Exonic
1083758409 11:64803230-64803252 CCCCGCGGCCTCAGAGCCACGGG - Exonic
1083848686 11:65352534-65352556 CCTTGTGGCCCCCGAGCTGCTGG - Exonic
1084037477 11:66521387-66521409 CCTCCCGGCCCCGGAGACCACGG - Intronic
1084069949 11:66727823-66727845 CCTCGCGTCGCCGGGGCTGCGGG - Intronic
1084192200 11:67504364-67504386 GCTCCCGGCCCCGGCGGCGCGGG - Intronic
1084266705 11:68008755-68008777 GCTCCCGGCCCCGGGGCCTCTGG - Intronic
1084888098 11:72223772-72223794 CGCCTCGGTCCCGGAGCCGCTGG - Intronic
1085640282 11:78188914-78188936 CGGCGCGGCCCCGGGGCTGCGGG - Exonic
1087138121 11:94740521-94740543 CCTCGGGCCCCCGGGACCGCGGG + Intronic
1089398879 11:118153073-118153095 CCTCGCGGTCCCGGAGCCCCGGG + Intergenic
1089554998 11:119311349-119311371 CCTCGTGACCCCGGAGCTGTTGG - Exonic
1090230791 11:125102131-125102153 CCTCGCCGCCCCGGAGGCTCTGG + Exonic
1090977174 11:131688176-131688198 CCTCGCGGCTCGGGGGGCGCGGG - Intronic
1092246647 12:6867752-6867774 CCTCGGGGCCTCGGGGCCTCGGG - Intronic
1093894821 12:24563339-24563361 CCGCGCGTCCCCGCCGCCGCCGG + Intergenic
1094840038 12:34339019-34339041 GTTCGCGCCCCCGGAGCTGCTGG + Intergenic
1094842663 12:34348570-34348592 ATTCGCGCCCCCGGAGCGGCTGG - Intergenic
1094843038 12:34349896-34349918 GCTCGCGCCCTCGGAGCAGCTGG - Intergenic
1095349147 12:41188782-41188804 CCCCGCGGCTGCGGAGCCGGCGG - Exonic
1095432067 12:42144820-42144842 AGTCGCGGCTCCGGAGCCGAAGG + Exonic
1096983708 12:55743322-55743344 GCTCGCGGCCCCGCTGCTGCTGG + Exonic
1097925435 12:65121610-65121632 CCTCGCGGCCCCGCCCCCGGGGG - Intergenic
1100390123 12:94140594-94140616 CCTTGCAGCCCCTCAGCCGCCGG - Intergenic
1101427416 12:104599358-104599380 CCGCGCGGTCCCGGAGCCATGGG + Intronic
1103749770 12:123150839-123150861 CCCCGCGGCCCCGGCCCGGCCGG + Intergenic
1103779576 12:123389590-123389612 GCTCGCGGCCCCGGCCCGGCGGG - Intronic
1104918262 12:132277652-132277674 CCCCGCGGCCCCGGCTCTGCTGG + Intronic
1106516955 13:30464706-30464728 CCTCGCGGCGGCGGCGGCGCAGG - Intronic
1113082873 13:106535728-106535750 GCGCGCGGCCGCGGAGCCGCGGG - Intergenic
1113494039 13:110713967-110713989 CCCCGCGGACCCGGAGGCGGCGG + Intronic
1114187364 14:20413203-20413225 CCTCCCCTTCCCGGAGCCGCCGG + Intronic
1118797091 14:69153257-69153279 TCTCGGGGCCCCGCAGCCGGCGG - Intergenic
1122162232 14:99793147-99793169 CCGGGCGGCCTGGGAGCCGCAGG - Intronic
1122283589 14:100638403-100638425 CCTCAGTGCCCCGGAGCCCCGGG + Intergenic
1123004383 14:105314445-105314467 CCCCGCCCCCCGGGAGCCGCGGG - Exonic
1124118293 15:26867477-26867499 CCTCGGGGCGCCTGAGCGGCAGG + Intronic
1125579730 15:40776604-40776626 CCTGGAGGCCCGGGAGCGGCAGG - Exonic
1128109550 15:65067936-65067958 GCGCGCGGCCCCGGACCCGTCGG + Exonic
1128309641 15:66622210-66622232 CCTCGCCGCCCCCGGGCTGCCGG + Intronic
1129388995 15:75211175-75211197 ACTCGTGGCCCCGGGGCAGCTGG - Exonic
1132372368 15:101307691-101307713 CATCGCAGCCCGGCAGCCGCTGG - Intronic
1132613419 16:828833-828855 CCCAGCGGCCCCGGAGCAGCAGG - Intergenic
1132697892 16:1210079-1210101 CCTCGCGGCTCCGGCACCACTGG - Exonic
1137244301 16:46689808-46689830 CCTCGCGGCCCTGGGCCCTCAGG + Intronic
1137683162 16:50368639-50368661 CCGGGCCGCCCCGGAGCCACTGG + Intronic
1139664912 16:68448555-68448577 CCTCGCGCCGCCGGAGCCAATGG + Exonic
1141558914 16:84853919-84853941 CTTCACAGCCCAGGAGCCGCAGG + Intronic
1142007585 16:87697042-87697064 CCCCGCGGCCCCTGAGTGGCAGG + Exonic
1142111448 16:88333715-88333737 CCTCGCGGGCCCGCATCCGTGGG - Intergenic
1142136314 16:88453470-88453492 GCGCCCAGCCCCGGAGCCGCTGG - Exonic
1142474273 17:180411-180433 CCTCTCTGCCCGGGGGCCGCGGG + Intronic
1143016161 17:3892387-3892409 CTTCGGGGCCCGGGAGGCGCAGG - Intronic
1146052836 17:29566879-29566901 CCCAGGGTCCCCGGAGCCGCGGG + Exonic
1146181000 17:30698027-30698049 CCTGGCGGCCGCAGAGCAGCGGG + Intergenic
1146183100 17:30709532-30709554 CCTCGCGGCGGCGGAGGCTCGGG - Intergenic
1146492667 17:33293285-33293307 CCCCGCCCGCCCGGAGCCGCGGG - Intronic
1147150398 17:38510683-38510705 CCCGGCGGCGCCGGAGCAGCTGG + Exonic
1147673443 17:42189858-42189880 CCACGCTGCCCCAGAACCGCAGG + Exonic
1148397726 17:47323810-47323832 CCCCACAGCCCCGGAGCCCCTGG + Intronic
1148757439 17:49980983-49981005 CCTCCCAGCCCTGGAGCCGCCGG + Intergenic
1148930023 17:51120597-51120619 CATCACGGCCCCGGAGCCGCCGG + Exonic
1149997162 17:61411396-61411418 CCTTGCGGCACCGGAGCGGCGGG - Intergenic
1152205593 17:78972933-78972955 CCTGGCGGCCCCAGAGCCTGAGG + Intronic
1152581170 17:81166181-81166203 CCGCCCGGCCCTGGCGCCGCGGG + Intergenic
1152739608 17:82013189-82013211 CCTCTCAGCCCCCGAGCTGCCGG + Intronic
1153451764 18:5238073-5238095 CCTCCCGGCCGCGGCGCTGCCGG - Intergenic
1153688320 18:7567635-7567657 GCCCGCGCCCCTGGAGCCGCTGG + Exonic
1154125598 18:11689620-11689642 CTGCGCGGCCTCGGAGCCGCCGG + Exonic
1154165911 18:12014345-12014367 CCCCGGAGACCCGGAGCCGCTGG - Exonic
1155152850 18:23136055-23136077 CCTCGCGCCGCAGGCGCCGCCGG - Exonic
1156036058 18:32769766-32769788 CATCCCGGCCCCGGAGCTGGTGG - Exonic
1158931074 18:62325438-62325460 CCGCGCGGCCCGGCAGGCGCGGG - Intronic
1158954237 18:62523886-62523908 CCTCTCGGACCCGGGGCCGCTGG + Exonic
1158976718 18:62716493-62716515 GCTGGCGCCCCCGGAGCCGCGGG + Exonic
1160775344 19:852803-852825 CCTCCCGGCCACGGGGCCTCTGG - Intronic
1160873250 19:1286372-1286394 CCTCGCGCCCCCGGAGCTCCGGG + Intronic
1160968604 19:1757571-1757593 CCGCGCGGCCCCGCGGCCGCGGG + Intronic
1161126759 19:2562196-2562218 CACCGCAGCCCCGGAGCTGCCGG + Intronic
1161212745 19:3076097-3076119 CCACGCGGCGCCCGTGCCGCCGG + Intergenic
1161581241 19:5082211-5082233 CCTGGAGCCCCTGGAGCCGCTGG + Intronic
1161663808 19:5563050-5563072 CCTCGCTGCCTCAGAGCCTCTGG - Intergenic
1161703003 19:5805184-5805206 CCCCGCGCCCTCTGAGCCGCCGG + Intergenic
1162070497 19:8149519-8149541 CCCCGGGTCCCCGGCGCCGCAGG - Exonic
1162581863 19:11536216-11536238 CCTGGCGGCCCGGGAGGGGCGGG - Intergenic
1162832977 19:13298662-13298684 CCTCGCCGCCCCGGGCCGGCCGG + Exonic
1162975694 19:14206236-14206258 CCTCGCGGCGGCGGAGGCTCGGG + Intergenic
1162975744 19:14206386-14206408 CGTCGGGGCCGCGGAGCTGCGGG - Intergenic
1162975859 19:14206713-14206735 CGTCGCGCCCCCGGTGCGGCCGG + Intergenic
1162977598 19:14217552-14217574 CCTGGCGGCCGCAGAGCAGCGGG - Intergenic
1165040513 19:33064813-33064835 GCCCGCGGCCCCCCAGCCGCTGG - Exonic
1165080153 19:33302258-33302280 ACCTGCCGCCCCGGAGCCGCTGG - Exonic
1166080865 19:40443434-40443456 ACTCGCGGCCCCGGAGGCAATGG - Intronic
1166358769 19:42242949-42242971 CCTCACGGCCCGAGACCCGCAGG - Intronic
1167096981 19:47379832-47379854 CCCAGCGGGCACGGAGCCGCAGG - Exonic
1168343808 19:55641051-55641073 CCCCGCGTCCCCGGCGCCGCCGG + Intronic
926089999 2:10043536-10043558 CCTCGCGGCGCGGGAGGGGCGGG - Exonic
926320113 2:11743616-11743638 CCTCCCTTCCCCGGAGCCCCAGG + Intronic
927652346 2:24920211-24920233 GCGCGTGGCCCCGGAGCCGCCGG - Intergenic
927897485 2:26793243-26793265 CCTCAAGGCCCCGGATCCTCCGG - Exonic
927904685 2:26848180-26848202 CGCCGCGGCGCCGGAGCTGCGGG - Exonic
927920770 2:26970700-26970722 ACCCTCCGCCCCGGAGCCGCCGG + Exonic
929000804 2:37345145-37345167 CCTCCCGGCTCAGCAGCCGCCGG - Intronic
931671739 2:64653941-64653963 GCTCCGGGCCCCGGCGCCGCAGG + Intronic
934746179 2:96761059-96761081 CCTGGCGGCGCCGGTGCTGCTGG + Exonic
934763817 2:96869639-96869661 CCCCGCAGCCCCGGGGCCGGAGG - Intronic
935622831 2:105144111-105144133 CTGCGCGGCCGCGGCGCCGCCGG - Intergenic
936396994 2:112138700-112138722 CCTCGCCTGCCCCGAGCCGCGGG + Exonic
938311160 2:130288828-130288850 AGGCGCGGCCCCGGAGCTGCAGG - Intergenic
938408071 2:131043745-131043767 CCTGGTGGCCCAGGAGCAGCAGG + Intronic
940009522 2:149038949-149038971 CCGCGGGGCCGCGGGGCCGCGGG + Intronic
941112124 2:161427191-161427213 GCTCGAGGCCGCGGGGCCGCGGG + Intronic
941367081 2:164621737-164621759 CTGGGCGGCCCCGGCGCCGCTGG + Exonic
941580613 2:167292792-167292814 ACTCGTGGCCCCGGAGCCTTAGG - Intergenic
942748686 2:179264522-179264544 CCCCAACGCCCCGGAGCCGCCGG - Exonic
947636084 2:231681288-231681310 CCGCGCGGGCCGGAAGCCGCAGG - Intergenic
947765317 2:232633910-232633932 CTGCGCGGCCCCGGCGCTGCAGG + Exonic
948430320 2:237914328-237914350 CCTGGGGGCCCGGGGGCCGCGGG - Intergenic
948802350 2:240438588-240438610 CCTCGCTGGCCCGGAGCAGGTGG + Intronic
1172019851 20:31906404-31906426 CCTCACGGCCCCGCAGCCTCTGG + Intronic
1175269009 20:57720562-57720584 GCTTGCAGCCTCGGAGCCGCTGG - Intergenic
1175428792 20:58888963-58888985 CATCGCGGCCCCCGCGCCCCCGG + Intronic
1175562162 20:59939814-59939836 CGGCGTGGCCCTGGAGCCGCGGG - Exonic
1175699003 20:61123827-61123849 CCTCGTGGCCCAGGAGCCTCTGG + Intergenic
1176033247 20:63023999-63024021 GCCCGCGGCCCCGGAGCCTAGGG + Intergenic
1176096523 20:63346921-63346943 CCTCAGGACCCCGGCGCCGCCGG + Intronic
1176285891 21:5019448-5019470 GCTCGTGGCCCTGGAGCAGCAGG + Intergenic
1176385845 21:6138230-6138252 CCTGGGGGCCCCGGAGGAGCGGG + Intergenic
1179737628 21:43400022-43400044 CCTGGGGGCCCCGGAGGAGCGGG - Intergenic
1179871290 21:44244027-44244049 GCTCGTGGCCCTGGAGCAGCAGG - Intergenic
1180064432 21:45405436-45405458 CCGCGCGGACCCCGAGCAGCAGG - Intronic
1181001878 22:19991636-19991658 CCTCAGGGCCCCAGAGCCCCAGG + Intronic
1183517042 22:38272751-38272773 CCTCCCCGCCCGGGAGCCGGCGG + Intronic
1184759486 22:46536742-46536764 CTGCGCGGCCGCGCAGCCGCCGG + Exonic
951543654 3:23806168-23806190 ACTCGCGCCGCCGGGGCCGCCGG + Intronic
956675031 3:71725316-71725338 CGCCGGGGCCCGGGAGCCGCCGG - Exonic
960950192 3:122994046-122994068 CCTCCCAGCCCAGGACCCGCAGG - Intronic
961336057 3:126180388-126180410 CCTGGAGCCCCCGGAGCCCCCGG + Intronic
961377251 3:126475396-126475418 CCGCCCGGCCCCGCAACCGCGGG - Exonic
961665014 3:128489251-128489273 CCGGGCGCCCCCGGAGCCGAGGG - Intronic
966808585 3:183825010-183825032 CCACGCGACCTCGGAGCTGCCGG - Intronic
968235796 3:197029539-197029561 TCTCACTGCCCCGGAGCCGCAGG + Intronic
968353204 3:198080246-198080268 CCCCGCAGCCCCGCAGCCCCTGG - Intergenic
968507391 4:977170-977192 CCTCGCAGCCTCGGAGGAGCCGG + Intronic
968601587 4:1512463-1512485 CCTTGCGGTCCTGGAGCTGCCGG + Intergenic
968601880 4:1513373-1513395 GTGCGCGGCGCCGGAGCCGCTGG + Intergenic
968608004 4:1544653-1544675 CCTCGCAGCCTCGGAGGAGCCGG + Intergenic
968902426 4:3437970-3437992 CTTGGTGGCCACGGAGCCGCTGG + Intronic
973754824 4:54064401-54064423 CTCCGCGGCCTCGGAGCCGGCGG - Exonic
973982092 4:56315418-56315440 CCTCGCGTCGCCGGGGCCTCGGG - Exonic
975991876 4:80266521-80266543 CCTCGCGGTCCCGGGGGCGGGGG - Intergenic
976389343 4:84493233-84493255 CCTCGCGGCCCCAGAGGTGGAGG + Exonic
979565685 4:122152281-122152303 CCTCGAGGCGCCGGCGACGCTGG + Intergenic
982712231 4:158769043-158769065 CTGCTCGGCGCCGGAGCCGCCGG - Intergenic
986330774 5:6714488-6714510 CCGCGCGGCCCCGCGCCCGCCGG + Intergenic
988726955 5:33936061-33936083 CCTCGCGGCGCGGGCGCGGCTGG + Intergenic
991435792 5:66596366-66596388 CCGCGCTGCACCCGAGCCGCGGG - Exonic
992105646 5:73447626-73447648 CTGCGCGGCGCGGGAGCCGCAGG - Exonic
997521518 5:134526817-134526839 CCGCGCGGCCCCGGAGGTGGAGG - Intronic
999113480 5:149141737-149141759 CCTTTGGGCTCCGGAGCCGCTGG + Exonic
999375123 5:151081171-151081193 CCGCGGGCCCCCGGAACCGCAGG - Intronic
999727044 5:154446099-154446121 CCGCGGGGCCCGGGTGCCGCGGG + Exonic
1000622983 5:163505883-163505905 CCTCCCAGCCCCGGATCCGAGGG + Intronic
1002368434 5:178730594-178730616 CCGCGAGGCTCCGGAACCGCCGG + Exonic
1002524357 5:179807024-179807046 CCTCGCGGCGCCGGCGACGGCGG - Intronic
1003175901 6:3751981-3752003 CCTCGCGGCCCCGGAGCCGCAGG + Exonic
1007431483 6:41779820-41779842 CCCCGCGGCCCGGGCGGCGCCGG + Exonic
1010414938 6:75602070-75602092 CCTCGCCGCTCCGGCGCGGCGGG + Exonic
1011277446 6:85643774-85643796 CTACGCGGCCGCGGAGCCGGGGG - Intronic
1011607378 6:89118102-89118124 CGGCGCGGCCCAGGGGCCGCGGG + Intergenic
1012399491 6:98832525-98832547 GCTCGCGGTTGCGGAGCCGCGGG + Intergenic
1012474187 6:99603308-99603330 CTGCGCGGCCCCCGAGGCGCGGG - Intergenic
1013369285 6:109455718-109455740 CCTCCCGGCTTCGGAGCCGCCGG - Exonic
1017672353 6:156779074-156779096 GCTCGCGGCCCCGCCGCCCCCGG - Exonic
1017738130 6:157381659-157381681 CCGCTCGGCCCCGCAGCCCCCGG - Exonic
1018694872 6:166383194-166383216 CCCCGCTGGCCGGGAGCCGCTGG - Intergenic
1019795241 7:3043796-3043818 CCTCCCGGCCCTGCAGCCCCTGG - Exonic
1023791904 7:43759084-43759106 GCTCGCGCTCCTGGAGCCGCCGG - Intronic
1026841238 7:73671001-73671023 CCTCCCGGCCCAGGAGCAGATGG + Exonic
1026968214 7:74453658-74453680 CCCCTCGGCCCCGGACCTGCGGG - Intergenic
1029487579 7:100852851-100852873 CCTCGCGGCCCCCGAGCTGTGGG + Intronic
1032194213 7:129780288-129780310 CCTCGCGGCACCTGAGCCAATGG - Intergenic
1034344817 7:150379556-150379578 CCGCGCGCCCCCCGAGCCCCGGG + Intronic
1035169598 7:157010152-157010174 CCCCGCGTCCTCGGAGCCGCCGG - Exonic
1035264990 7:157685477-157685499 CCTCGGGGAGCCGGAGCCGGCGG - Intronic
1036600375 8:10255338-10255360 CCTGGCGGGCCAGGAGCCCCAGG + Intronic
1036609265 8:10335383-10335405 CCTCGCGGCTTTGGAGCCACGGG - Intronic
1036788867 8:11704733-11704755 CCCTGCGTCCCCGGAGTCGCTGG - Intronic
1037811385 8:22089155-22089177 CCTCGTCGCGCCGGGGCCGCCGG + Intronic
1038542493 8:28401841-28401863 AGCCGCGGCCCCGGAGCCGGAGG - Intronic
1041689900 8:60678705-60678727 CCGCGCGCACCCGAAGCCGCGGG - Intergenic
1041690086 8:60679360-60679382 CCGCGCGCCCCCGCCGCCGCCGG - Intronic
1042155665 8:65841817-65841839 CCTCTCGGCCGAGGAGCCCCAGG - Exonic
1042553166 8:70012229-70012251 CCTCACAGCCCCGGAGCCTTGGG - Intergenic
1043502962 8:80874332-80874354 CGCCGCCGCCCGGGAGCCGCGGG + Intronic
1045664025 8:104466888-104466910 CCTCGCGGCTCCTGATCCGCGGG - Exonic
1049105266 8:140608792-140608814 CCTTGCTGCCCTGGAGCAGCTGG - Intronic
1049651300 8:143771198-143771220 CCTCGGGGCTCCCGAGCTGCGGG + Intergenic
1049756783 8:144314326-144314348 CCTAGAGGCCCCGGAGGAGCTGG + Exonic
1049798885 8:144508780-144508802 CCTTCCGGCCCTGGAGCCGGTGG + Intergenic
1053003368 9:34589871-34589893 GCGCGCGGCCGCGGAGGCGCGGG - Intronic
1053188214 9:36036969-36036991 CCGGGCGGCTCCAGAGCCGCGGG - Exonic
1054255025 9:62802503-62802525 CATCGCCACCCCGGGGCCGCGGG + Intergenic
1060087280 9:120714212-120714234 CCCCGCGGCCCCGCCGCCACCGG + Exonic
1061208092 9:129175953-129175975 CCTCCCTCCCCCGGGGCCGCCGG + Exonic
1061883005 9:133577359-133577381 CCTCGCAGCCCCGGCCCCCCGGG - Intergenic
1062008086 9:134251559-134251581 GCTCCCGGCCCCGGGGCCGCTGG + Intergenic
1062041856 9:134407981-134408003 CCACGCTGCTCCGGAGCAGCGGG - Intronic
1062272235 9:135714808-135714830 CCGCGCGCCCCCGCAGCCGCCGG + Intronic
1062491845 9:136808516-136808538 CCTCGCGGCCCCCGAGCCGCGGG + Intronic
1189446220 X:41084613-41084635 CCTCGCGCCCCCGCAGCCAGTGG + Intergenic
1191184122 X:57592180-57592202 CTTGGGGGCCCCGGAGCAGCAGG - Exonic
1197746075 X:129932705-129932727 CCTCGGCGCCCCGTGGCCGCAGG + Intergenic
1200098203 X:153673902-153673924 CAGCGCGGCCGCGGCGCCGCAGG + Intronic