ID: 1003177294

View in Genome Browser
Species Human (GRCh38)
Location 6:3761579-3761601
Sequence TAGCTGCCTCCCTGCGGAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1003177288_1003177294 18 Left 1003177288 6:3761538-3761560 CCTGGGCCAGCAGCTGCTGTGCT 0: 318
1: 144
2: 44
3: 76
4: 859
Right 1003177294 6:3761579-3761601 TAGCTGCCTCCCTGCGGAGCAGG No data
1003177289_1003177294 12 Left 1003177289 6:3761544-3761566 CCAGCAGCTGCTGTGCTCGACTT 0: 70
1: 101
2: 248
3: 100
4: 184
Right 1003177294 6:3761579-3761601 TAGCTGCCTCCCTGCGGAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1003177294 Original CRISPR TAGCTGCCTCCCTGCGGAGC AGG Intergenic
No off target data available for this crispr