ID: 1003178473

View in Genome Browser
Species Human (GRCh38)
Location 6:3771735-3771757
Sequence GCTGGCTGGCCCGCAAGCCC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1003178461_1003178473 28 Left 1003178461 6:3771684-3771706 CCAGCTAGAGTTCCGGGTGGGCG 0: 33
1: 524
2: 598
3: 502
4: 442
Right 1003178473 6:3771735-3771757 GCTGGCTGGCCCGCAAGCCCCGG No data
1003178470_1003178473 -8 Left 1003178470 6:3771720-3771742 CCCGCACTCGGAGCGGCTGGCTG No data
Right 1003178473 6:3771735-3771757 GCTGGCTGGCCCGCAAGCCCCGG No data
1003178471_1003178473 -9 Left 1003178471 6:3771721-3771743 CCGCACTCGGAGCGGCTGGCTGG No data
Right 1003178473 6:3771735-3771757 GCTGGCTGGCCCGCAAGCCCCGG No data
1003178464_1003178473 16 Left 1003178464 6:3771696-3771718 CCGGGTGGGCGTGGGCTTTGCGG No data
Right 1003178473 6:3771735-3771757 GCTGGCTGGCCCGCAAGCCCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1003178473 Original CRISPR GCTGGCTGGCCCGCAAGCCC CGG Intergenic
No off target data available for this crispr