ID: 1003180406

View in Genome Browser
Species Human (GRCh38)
Location 6:3786155-3786177
Sequence GAAAACATAGTGTCCTGAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1003180402_1003180406 27 Left 1003180402 6:3786105-3786127 CCACTGGAGAGAGCTGAACCTCA No data
Right 1003180406 6:3786155-3786177 GAAAACATAGTGTCCTGAGCAGG No data
1003180404_1003180406 -4 Left 1003180404 6:3786136-3786158 CCAGACTCCAAGAGACACAGAAA No data
Right 1003180406 6:3786155-3786177 GAAAACATAGTGTCCTGAGCAGG No data
1003180403_1003180406 9 Left 1003180403 6:3786123-3786145 CCTCAAACTCACACCAGACTCCA No data
Right 1003180406 6:3786155-3786177 GAAAACATAGTGTCCTGAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1003180406 Original CRISPR GAAAACATAGTGTCCTGAGC AGG Intergenic
No off target data available for this crispr