ID: 1003183874

View in Genome Browser
Species Human (GRCh38)
Location 6:3813949-3813971
Sequence GCGGGCTCCCAGGATGCAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1003183872_1003183874 -7 Left 1003183872 6:3813933-3813955 CCTTGGATGGGTGTTCGCGGGCT No data
Right 1003183874 6:3813949-3813971 GCGGGCTCCCAGGATGCAGCAGG No data
1003183871_1003183874 -6 Left 1003183871 6:3813932-3813954 CCCTTGGATGGGTGTTCGCGGGC No data
Right 1003183874 6:3813949-3813971 GCGGGCTCCCAGGATGCAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1003183874 Original CRISPR GCGGGCTCCCAGGATGCAGC AGG Intergenic
No off target data available for this crispr