ID: 1003184353

View in Genome Browser
Species Human (GRCh38)
Location 6:3817933-3817955
Sequence CCTCCTAAGAGGGAAGGGTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1003184353_1003184361 10 Left 1003184353 6:3817933-3817955 CCTGACCCTTCCCTCTTAGGAGG No data
Right 1003184361 6:3817966-3817988 CCCCACTCCCTGAGTCTCTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1003184353 Original CRISPR CCTCCTAAGAGGGAAGGGTC AGG (reversed) Intergenic
No off target data available for this crispr