ID: 1003184361

View in Genome Browser
Species Human (GRCh38)
Location 6:3817966-3817988
Sequence CCCCACTCCCTGAGTCTCTG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1003184359_1003184361 -1 Left 1003184359 6:3817944-3817966 CCTCTTAGGAGGGCTCTCATGTC No data
Right 1003184361 6:3817966-3817988 CCCCACTCCCTGAGTCTCTGTGG No data
1003184349_1003184361 21 Left 1003184349 6:3817922-3817944 CCTCTCTCCCACCTGACCCTTCC No data
Right 1003184361 6:3817966-3817988 CCCCACTCCCTGAGTCTCTGTGG No data
1003184351_1003184361 13 Left 1003184351 6:3817930-3817952 CCACCTGACCCTTCCCTCTTAGG No data
Right 1003184361 6:3817966-3817988 CCCCACTCCCTGAGTCTCTGTGG No data
1003184357_1003184361 4 Left 1003184357 6:3817939-3817961 CCTTCCCTCTTAGGAGGGCTCTC No data
Right 1003184361 6:3817966-3817988 CCCCACTCCCTGAGTCTCTGTGG No data
1003184358_1003184361 0 Left 1003184358 6:3817943-3817965 CCCTCTTAGGAGGGCTCTCATGT No data
Right 1003184361 6:3817966-3817988 CCCCACTCCCTGAGTCTCTGTGG No data
1003184356_1003184361 5 Left 1003184356 6:3817938-3817960 CCCTTCCCTCTTAGGAGGGCTCT No data
Right 1003184361 6:3817966-3817988 CCCCACTCCCTGAGTCTCTGTGG No data
1003184353_1003184361 10 Left 1003184353 6:3817933-3817955 CCTGACCCTTCCCTCTTAGGAGG No data
Right 1003184361 6:3817966-3817988 CCCCACTCCCTGAGTCTCTGTGG No data
1003184348_1003184361 22 Left 1003184348 6:3817921-3817943 CCCTCTCTCCCACCTGACCCTTC No data
Right 1003184361 6:3817966-3817988 CCCCACTCCCTGAGTCTCTGTGG No data
1003184350_1003184361 14 Left 1003184350 6:3817929-3817951 CCCACCTGACCCTTCCCTCTTAG No data
Right 1003184361 6:3817966-3817988 CCCCACTCCCTGAGTCTCTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1003184361 Original CRISPR CCCCACTCCCTGAGTCTCTG TGG Intergenic