ID: 1003185470

View in Genome Browser
Species Human (GRCh38)
Location 6:3826534-3826556
Sequence GCGTCCACCCCTGGCACACG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1003185466_1003185470 3 Left 1003185466 6:3826508-3826530 CCATGGTGGCAGCAGGGCCCTTG No data
Right 1003185470 6:3826534-3826556 GCGTCCACCCCTGGCACACGTGG No data
1003185458_1003185470 25 Left 1003185458 6:3826486-3826508 CCCAAGGCGGGCAAGGTCCCAGC No data
Right 1003185470 6:3826534-3826556 GCGTCCACCCCTGGCACACGTGG No data
1003185459_1003185470 24 Left 1003185459 6:3826487-3826509 CCAAGGCGGGCAAGGTCCCAGCC No data
Right 1003185470 6:3826534-3826556 GCGTCCACCCCTGGCACACGTGG No data
1003185464_1003185470 8 Left 1003185464 6:3826503-3826525 CCCAGCCATGGTGGCAGCAGGGC No data
Right 1003185470 6:3826534-3826556 GCGTCCACCCCTGGCACACGTGG No data
1003185465_1003185470 7 Left 1003185465 6:3826504-3826526 CCAGCCATGGTGGCAGCAGGGCC No data
Right 1003185470 6:3826534-3826556 GCGTCCACCCCTGGCACACGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1003185470 Original CRISPR GCGTCCACCCCTGGCACACG TGG Intergenic
No off target data available for this crispr