ID: 1003186393

View in Genome Browser
Species Human (GRCh38)
Location 6:3835143-3835165
Sequence TTGTGTTAGGGCAGGGTGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1003186384_1003186393 24 Left 1003186384 6:3835096-3835118 CCTGGGTTTCTGCATGTCAGTGA No data
Right 1003186393 6:3835143-3835165 TTGTGTTAGGGCAGGGTGGAAGG No data
1003186383_1003186393 25 Left 1003186383 6:3835095-3835117 CCCTGGGTTTCTGCATGTCAGTG No data
Right 1003186393 6:3835143-3835165 TTGTGTTAGGGCAGGGTGGAAGG No data
1003186386_1003186393 -4 Left 1003186386 6:3835124-3835146 CCAGCAGGTGACAGTCCTGTTGT No data
Right 1003186393 6:3835143-3835165 TTGTGTTAGGGCAGGGTGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1003186393 Original CRISPR TTGTGTTAGGGCAGGGTGGA AGG Intergenic
No off target data available for this crispr