ID: 1003187148

View in Genome Browser
Species Human (GRCh38)
Location 6:3841839-3841861
Sequence TCATCCTGGAAAGCAGCTCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1003187141_1003187148 18 Left 1003187141 6:3841798-3841820 CCTCCCTCTACGAGTCTCATTAT No data
Right 1003187148 6:3841839-3841861 TCATCCTGGAAAGCAGCTCCAGG No data
1003187140_1003187148 29 Left 1003187140 6:3841787-3841809 CCTCAGGGTGGCCTCCCTCTACG No data
Right 1003187148 6:3841839-3841861 TCATCCTGGAAAGCAGCTCCAGG No data
1003187143_1003187148 14 Left 1003187143 6:3841802-3841824 CCTCTACGAGTCTCATTATCCAG No data
Right 1003187148 6:3841839-3841861 TCATCCTGGAAAGCAGCTCCAGG No data
1003187145_1003187148 -5 Left 1003187145 6:3841821-3841843 CCAGGAATCCTGCAGCAGTCATC No data
Right 1003187148 6:3841839-3841861 TCATCCTGGAAAGCAGCTCCAGG No data
1003187142_1003187148 15 Left 1003187142 6:3841801-3841823 CCCTCTACGAGTCTCATTATCCA No data
Right 1003187148 6:3841839-3841861 TCATCCTGGAAAGCAGCTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1003187148 Original CRISPR TCATCCTGGAAAGCAGCTCC AGG Intergenic
No off target data available for this crispr