ID: 1003189531

View in Genome Browser
Species Human (GRCh38)
Location 6:3861987-3862009
Sequence GTTCTCCCACAACACAGTGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1003189521_1003189531 25 Left 1003189521 6:3861939-3861961 CCCCTCCAGAAGATGGAAGAGAT No data
Right 1003189531 6:3861987-3862009 GTTCTCCCACAACACAGTGCTGG No data
1003189527_1003189531 -6 Left 1003189527 6:3861970-3861992 CCAAGCCCACCAGAGCAGTTCTC No data
Right 1003189531 6:3861987-3862009 GTTCTCCCACAACACAGTGCTGG No data
1003189523_1003189531 23 Left 1003189523 6:3861941-3861963 CCTCCAGAAGATGGAAGAGATGG No data
Right 1003189531 6:3861987-3862009 GTTCTCCCACAACACAGTGCTGG No data
1003189526_1003189531 20 Left 1003189526 6:3861944-3861966 CCAGAAGATGGAAGAGATGGGAG No data
Right 1003189531 6:3861987-3862009 GTTCTCCCACAACACAGTGCTGG No data
1003189522_1003189531 24 Left 1003189522 6:3861940-3861962 CCCTCCAGAAGATGGAAGAGATG No data
Right 1003189531 6:3861987-3862009 GTTCTCCCACAACACAGTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1003189531 Original CRISPR GTTCTCCCACAACACAGTGC TGG Intergenic
No off target data available for this crispr