ID: 1003190396

View in Genome Browser
Species Human (GRCh38)
Location 6:3869545-3869567
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1003190386_1003190396 22 Left 1003190386 6:3869500-3869522 CCTTGAAGAGTGTTCAGCGCAGC No data
Right 1003190396 6:3869545-3869567 TTTCACCTGGGCCAGATAATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1003190396 Original CRISPR TTTCACCTGGGCCAGATAAT GGG Intergenic
No off target data available for this crispr