ID: 1003195059

View in Genome Browser
Species Human (GRCh38)
Location 6:3906849-3906871
Sequence TGGCCTCCATGGTGGCACGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 104
Summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 96}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1003195059_1003195065 5 Left 1003195059 6:3906849-3906871 CCCACGTGCCACCATGGAGGCCA 0: 1
1: 0
2: 1
3: 6
4: 96
Right 1003195065 6:3906877-3906899 TTTCTCAGTGACTTTCTGCATGG 0: 1
1: 1
2: 0
3: 51
4: 340
1003195059_1003195066 9 Left 1003195059 6:3906849-3906871 CCCACGTGCCACCATGGAGGCCA 0: 1
1: 0
2: 1
3: 6
4: 96
Right 1003195066 6:3906881-3906903 TCAGTGACTTTCTGCATGGCAGG 0: 1
1: 0
2: 1
3: 19
4: 205

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1003195059 Original CRISPR TGGCCTCCATGGTGGCACGT GGG (reversed) Intergenic
900818534 1:4869093-4869115 TGGCCTCCATGCTGGGCCCTTGG - Intergenic
901255993 1:7827308-7827330 TGGGCACCATGGCGGCAGGTGGG - Exonic
903184567 1:21622119-21622141 TGGCCTCCCGGGTGGCACTGTGG - Intronic
908979885 1:69942890-69942912 TGGGCTACATGGTGGCTCATAGG - Intronic
914449435 1:147777730-147777752 TGGCCTCCAATGAGGCACGGAGG - Intergenic
916895671 1:169159476-169159498 TGGCCTCCATGTTGGTGGGTTGG - Intronic
921600622 1:217102841-217102863 AGGCCTCTAAGGTGGCATGTAGG + Intronic
1065778605 10:29145538-29145560 TGTCTTACATGGTGGCACGCAGG - Intergenic
1066646514 10:37616207-37616229 TTCCCTCCCTGGAGGCACGTGGG - Intergenic
1069286284 10:66719823-66719845 TGGCCTCAATGGTAGCAGCTAGG + Intronic
1071520556 10:86329415-86329437 TGGCTTCCATGGAGGCATATTGG - Intronic
1075201522 10:120408604-120408626 TGGCCTCCAGGGTGGGCCGAGGG - Intergenic
1076265397 10:129105827-129105849 TGGCCTCTATGGTGGGATGCTGG - Intergenic
1076335465 10:129703713-129703735 TGGCGTCCGTGGTGGCACCTGGG - Intronic
1077014476 11:393631-393653 GGGCCTCCATGGAGTCCCGTTGG + Intronic
1080635273 11:34118255-34118277 GGGCCTCCATGGTGGCAACGTGG - Exonic
1082014797 11:47476849-47476871 TGGCCTCAATGTTGGCTCTTTGG - Exonic
1084331451 11:68432898-68432920 TGGCCTCCATGGTCACACGTAGG + Intronic
1085385586 11:76156242-76156264 TGGCATGCATGTTGGCATGTTGG + Intergenic
1087008479 11:93491762-93491784 TGGCCCCCATGCTGGCATGCTGG + Intronic
1087060077 11:93968762-93968784 TGGACTCCATGGAGTCACATTGG + Intergenic
1089171642 11:116515840-116515862 TGGCCTCTGGGATGGCACGTGGG + Intergenic
1091834646 12:3577030-3577052 TGGACTCCAGGGTGGCACAGCGG - Intronic
1102028462 12:109726761-109726783 TGGCTTCCAGGGTGGGACTTAGG + Intronic
1104102293 12:125624136-125624158 TGGCCTCCATGATTGGACCTTGG - Intronic
1104984705 12:132590100-132590122 TGGCCTCCCTAGTGGCAGGGTGG - Intergenic
1112197355 13:97238784-97238806 TGGGCTGCCTGGTGGCACCTGGG + Intronic
1112681070 13:101765495-101765517 TGGCCTCCATGGAGGCAAGCAGG + Intronic
1119522122 14:75294206-75294228 TGGTTTCCACGGTGACACGTAGG + Intergenic
1120469390 14:84903464-84903486 TGGCTTCCATGGTGGCCTGTGGG + Intergenic
1121908783 14:97770401-97770423 TAACCTCCATTGTGGCAGGTAGG - Intergenic
1202855057 14_GL000225v1_random:44587-44609 GGCCCTCCATGGTGGCAGCTGGG - Intergenic
1202857480 14_GL000225v1_random:59877-59899 GGCCCTCCATGGTGGCAGCTGGG - Intergenic
1202857887 14_GL000225v1_random:63131-63153 GGCCCTCCATGGTGGCAGCTGGG + Intergenic
1202863938 14_GL000225v1_random:103766-103788 GGCCCTCCATGGTGACAGGTGGG + Intergenic
1132544138 16:525372-525394 TGGGCTCCATGATGGCACTGGGG + Intergenic
1138036010 16:53607005-53607027 TGGCCTTCAAGGTGGTACGAAGG + Intronic
1138328939 16:56197206-56197228 TGGCCCCCAGGGTCGCACGTTGG + Intronic
1143202502 17:5122532-5122554 CGGCCTCCCGGGTGGCACGCGGG - Intronic
1146935425 17:36809881-36809903 TGGCCACGATGGGGGCACGGAGG - Intergenic
1147546782 17:41408119-41408141 TGGCCTCCATCTGGGCAGGTAGG - Intergenic
1148128474 17:45248588-45248610 TGCCCTCCAAGTTGGCACGGGGG - Intergenic
1148436005 17:47685845-47685867 TGGCCTCCAAGGTGCCAGCTTGG - Intergenic
1148436086 17:47686698-47686720 TGGCCTCCAAGGTGCCAGCTTGG + Intergenic
1154394484 18:13974553-13974575 TGGCCTCCAAGATGGCCCATAGG - Intergenic
1159925544 18:74265905-74265927 TGGCCTCCAGGGTTGGAGGTGGG - Intronic
1161971306 19:7582438-7582460 TGGCCTCCTTGGTGGCCCTCCGG + Intergenic
1163442721 19:17329709-17329731 TGGCCGCCATGGGGGCAGGGGGG + Intronic
1165225065 19:34349019-34349041 TGGCCTGCACGGTGGCTGGTCGG + Exonic
1166539249 19:43594739-43594761 GGACCTCCATGGTCGCACCTAGG + Intronic
1167375587 19:49109271-49109293 TGGCCTCCCTGTTGGCACTCAGG + Intergenic
926121898 2:10245792-10245814 TGGCCTCCGTGGTGACAGGAGGG + Intergenic
927917126 2:26944568-26944590 TGGCCTCCCTGGGGGCCGGTGGG - Intronic
929931789 2:46262713-46262735 TGGACACCATGGTGACAGGTTGG - Intergenic
937225504 2:120366537-120366559 TGCCCTCCAGGGTGACATGTGGG + Intergenic
940965881 2:159836774-159836796 TGGCCTCCAGTGTGGCCCTTCGG + Intronic
947314863 2:228845562-228845584 TGACCTCCATGGTGACAGGATGG - Intergenic
948795351 2:240399668-240399690 TGGCCTCCAGGGTGGGATGGAGG - Intergenic
948850322 2:240702454-240702476 TGGTGACCATGGTGGCAGGTAGG - Intergenic
1172120109 20:32593383-32593405 GGGCCTCCCTGGTGGGACATGGG + Intronic
1175575328 20:60056587-60056609 TGGGCTCCATGGTGGCTCTGTGG + Intronic
1179586780 21:42378370-42378392 TGGGCTCCATAGTGGCAGGTAGG - Intronic
1181119517 22:20656663-20656685 TGCTCTCCACGGGGGCACGTTGG - Intergenic
1183105942 22:35615263-35615285 TGGCCTCCCTGGGGGCAGGGTGG - Intronic
1183394148 22:37561758-37561780 TGGCCTCCAGGATGAGACGTGGG + Intronic
1184099780 22:42336004-42336026 CAGCCTGCATGGTGGCAGGTTGG - Intronic
1185130474 22:49035925-49035947 GGGGCTCCATGCTGGCCCGTGGG - Intergenic
953492280 3:43362335-43362357 CTGCCCCCATGGTGGCAAGTTGG + Intronic
953571250 3:44073425-44073447 TGGCCTGCAGGGTGGCAGGCTGG - Intergenic
954293347 3:49661185-49661207 TGGCCTGCATAGTGGCCTGTGGG - Exonic
956884345 3:73544020-73544042 TGGCCACCATGGTGAAACCTCGG + Intronic
960594139 3:119392605-119392627 AGGCCTCCATGGTGACCCCTGGG + Intronic
966855919 3:184193746-184193768 TGGCCTACATGGTGGCCCAGGGG - Exonic
973172592 4:47164006-47164028 TGTCTTACATGGTGGCAGGTGGG + Intronic
978404337 4:108363620-108363642 TGGCTTCCATGGTGAGAAGTAGG + Intergenic
987288622 5:16486783-16486805 GGTCCTGCATGATGGCACGTTGG - Intronic
987840993 5:23222667-23222689 TGGGCTGCATTGTGGCAGGTGGG + Intergenic
988408510 5:30855560-30855582 TGTCTTACATGGTGGCAGGTGGG - Intergenic
988628049 5:32898887-32898909 TGGCATCCATGGTGCCACTGGGG + Intergenic
991627750 5:68621929-68621951 TGTCATCCATGGCGGGACGTGGG + Intergenic
996841411 5:127851038-127851060 AAGCCTCCATGGTGGCACCAGGG - Intergenic
1003195059 6:3906849-3906871 TGGCCTCCATGGTGGCACGTGGG - Intergenic
1003306788 6:4936084-4936106 GGGGCTCCATGAAGGCACGTGGG + Intronic
1010073640 6:71773845-71773867 TTTCCTCCATGGTGGGAAGTAGG - Intergenic
1013078471 6:106791733-106791755 TGGCCTCCCTGGTGGCTTGCAGG - Intergenic
1013126371 6:107188611-107188633 TGGCCTCCATTGTTGGAGGTGGG + Intronic
1014289416 6:119540605-119540627 TGGTGTCCATGCTGGCACCTGGG + Intergenic
1019729195 7:2621185-2621207 TGGGATCCAGGGTGCCACGTGGG - Intergenic
1032448488 7:132004871-132004893 TGGGCTCCTTGGTGTCACGCAGG - Intergenic
1034589802 7:152129323-152129345 CGGCCTCCATGGAGGAAAGTGGG - Intergenic
1039490931 8:37946966-37946988 CAGCCTCCATGGTGGGAGGTGGG + Intergenic
1045296757 8:100878128-100878150 TGGTGGCGATGGTGGCACGTGGG + Intergenic
1048286480 8:133145767-133145789 TGGCCTCCAGGGTGCCAGGCAGG + Intergenic
1050004748 9:1118485-1118507 TTTTCTCCATGGTGGCCCGTGGG + Intergenic
1057030182 9:91769371-91769393 TGGCCTCCTTGGTGGCAGCCTGG + Intronic
1061753777 9:132798823-132798845 GGGGATCCATGGTGGCAAGTGGG + Intronic
1062020481 9:134317020-134317042 TGGCTTCCAGGGTGTCACATGGG + Intergenic
1062445882 9:136594417-136594439 TGGACTCCCTGTTGGCACCTTGG + Intergenic
1203768159 EBV:37168-37190 TGGCCACCATGGTGGCCCCGAGG - Intergenic
1203740381 Un_GL000216v2:172250-172272 GGCCCTCCATGGTGACAGGTGGG - Intergenic
1188064850 X:25646318-25646340 TGGCCGCCATGGGGGCGCGGCGG + Intergenic
1189308263 X:40003491-40003513 TGGCCTCCCTGGGGGCAGGTGGG - Intergenic
1191976638 X:66878956-66878978 TGGTCCCCATGGTGGCATATAGG - Intergenic
1199327714 X:146519992-146520014 TGGCCTCCATGGTTTCAGATGGG - Intergenic