ID: 1003197506

View in Genome Browser
Species Human (GRCh38)
Location 6:3928225-3928247
Sequence TGTCTAGTGGGTGGAGGCTA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1003197506_1003197519 24 Left 1003197506 6:3928225-3928247 CCCTAGCCTCCACCCACTAGACA No data
Right 1003197519 6:3928272-3928294 TGACAACCAAATGTCCCCGGGGG No data
1003197506_1003197516 21 Left 1003197506 6:3928225-3928247 CCCTAGCCTCCACCCACTAGACA No data
Right 1003197516 6:3928269-3928291 TTGTGACAACCAAATGTCCCCGG No data
1003197506_1003197518 23 Left 1003197506 6:3928225-3928247 CCCTAGCCTCCACCCACTAGACA No data
Right 1003197518 6:3928271-3928293 GTGACAACCAAATGTCCCCGGGG No data
1003197506_1003197517 22 Left 1003197506 6:3928225-3928247 CCCTAGCCTCCACCCACTAGACA No data
Right 1003197517 6:3928270-3928292 TGTGACAACCAAATGTCCCCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1003197506 Original CRISPR TGTCTAGTGGGTGGAGGCTA GGG (reversed) Intergenic
No off target data available for this crispr