ID: 1003198809

View in Genome Browser
Species Human (GRCh38)
Location 6:3939828-3939850
Sequence GAGCAGGGACGCTGAGCCCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1003198800_1003198809 11 Left 1003198800 6:3939794-3939816 CCTGCCCTGGCTAAATACCTGCA No data
Right 1003198809 6:3939828-3939850 GAGCAGGGACGCTGAGCCCAGGG No data
1003198799_1003198809 16 Left 1003198799 6:3939789-3939811 CCAGACCTGCCCTGGCTAAATAC No data
Right 1003198809 6:3939828-3939850 GAGCAGGGACGCTGAGCCCAGGG No data
1003198802_1003198809 7 Left 1003198802 6:3939798-3939820 CCCTGGCTAAATACCTGCAGGTG No data
Right 1003198809 6:3939828-3939850 GAGCAGGGACGCTGAGCCCAGGG No data
1003198805_1003198809 -6 Left 1003198805 6:3939811-3939833 CCTGCAGGTGGATCTCAGAGCAG No data
Right 1003198809 6:3939828-3939850 GAGCAGGGACGCTGAGCCCAGGG No data
1003198803_1003198809 6 Left 1003198803 6:3939799-3939821 CCTGGCTAAATACCTGCAGGTGG No data
Right 1003198809 6:3939828-3939850 GAGCAGGGACGCTGAGCCCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1003198809 Original CRISPR GAGCAGGGACGCTGAGCCCA GGG Intergenic
No off target data available for this crispr