ID: 1003198818

View in Genome Browser
Species Human (GRCh38)
Location 6:3939868-3939890
Sequence TCAGCTCCACAGATGGAGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1003198818_1003198820 -4 Left 1003198818 6:3939868-3939890 CCAGGCTCCATCTGTGGAGCTGA No data
Right 1003198820 6:3939887-3939909 CTGACATAACTGCCATGTGCTGG No data
1003198818_1003198823 18 Left 1003198818 6:3939868-3939890 CCAGGCTCCATCTGTGGAGCTGA No data
Right 1003198823 6:3939909-3939931 GACATTAATGATTTGCTTCAGGG No data
1003198818_1003198822 17 Left 1003198818 6:3939868-3939890 CCAGGCTCCATCTGTGGAGCTGA No data
Right 1003198822 6:3939908-3939930 GGACATTAATGATTTGCTTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1003198818 Original CRISPR TCAGCTCCACAGATGGAGCC TGG (reversed) Intergenic
No off target data available for this crispr