ID: 1003203830

View in Genome Browser
Species Human (GRCh38)
Location 6:3989388-3989410
Sequence ACCTAGTTCTTAAAGGAAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1003203830_1003203833 1 Left 1003203830 6:3989388-3989410 CCTTCTTCCTTTAAGAACTAGGT No data
Right 1003203833 6:3989412-3989434 TTAAACACATGGTATGTACCAGG No data
1003203830_1003203832 -10 Left 1003203830 6:3989388-3989410 CCTTCTTCCTTTAAGAACTAGGT No data
Right 1003203832 6:3989401-3989423 AGAACTAGGTATTAAACACATGG No data
1003203830_1003203836 20 Left 1003203830 6:3989388-3989410 CCTTCTTCCTTTAAGAACTAGGT No data
Right 1003203836 6:3989431-3989453 CAGGCATTGTGCTAGACACTGGG No data
1003203830_1003203835 19 Left 1003203830 6:3989388-3989410 CCTTCTTCCTTTAAGAACTAGGT No data
Right 1003203835 6:3989430-3989452 CCAGGCATTGTGCTAGACACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1003203830 Original CRISPR ACCTAGTTCTTAAAGGAAGA AGG (reversed) Intergenic
No off target data available for this crispr