ID: 1003204297

View in Genome Browser
Species Human (GRCh38)
Location 6:3993013-3993035
Sequence GCTCAAGCATGTGCACTCAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1003204297_1003204303 8 Left 1003204297 6:3993013-3993035 CCTTTGAGTGCACATGCTTGAGC No data
Right 1003204303 6:3993044-3993066 CCAACTCCTGAGATCATATTGGG No data
1003204297_1003204301 7 Left 1003204297 6:3993013-3993035 CCTTTGAGTGCACATGCTTGAGC No data
Right 1003204301 6:3993043-3993065 CCCAACTCCTGAGATCATATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1003204297 Original CRISPR GCTCAAGCATGTGCACTCAA AGG (reversed) Intergenic
No off target data available for this crispr