ID: 1003207271

View in Genome Browser
Species Human (GRCh38)
Location 6:4024241-4024263
Sequence GCTCAAGTGCTGCAGGTACT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 117
Summary {0: 1, 1: 0, 2: 1, 3: 4, 4: 111}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1003207266_1003207271 1 Left 1003207266 6:4024217-4024239 CCCAGGCTGTTCTTGAACTACTG 0: 5
1: 723
2: 22751
3: 41778
4: 61536
Right 1003207271 6:4024241-4024263 GCTCAAGTGCTGCAGGTACTAGG 0: 1
1: 0
2: 1
3: 4
4: 111
1003207267_1003207271 0 Left 1003207267 6:4024218-4024240 CCAGGCTGTTCTTGAACTACTGG 0: 5
1: 665
2: 23486
3: 100520
4: 169249
Right 1003207271 6:4024241-4024263 GCTCAAGTGCTGCAGGTACTAGG 0: 1
1: 0
2: 1
3: 4
4: 111
1003207265_1003207271 9 Left 1003207265 6:4024209-4024231 CCATGTTGCCCAGGCTGTTCTTG 0: 161
1: 8854
2: 61230
3: 135917
4: 179761
Right 1003207271 6:4024241-4024263 GCTCAAGTGCTGCAGGTACTAGG 0: 1
1: 0
2: 1
3: 4
4: 111
1003207264_1003207271 10 Left 1003207264 6:4024208-4024230 CCCATGTTGCCCAGGCTGTTCTT 0: 29
1: 1281
2: 4868
3: 8047
4: 7434
Right 1003207271 6:4024241-4024263 GCTCAAGTGCTGCAGGTACTAGG 0: 1
1: 0
2: 1
3: 4
4: 111

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1003207271 Original CRISPR GCTCAAGTGCTGCAGGTACT AGG Intronic
901089164 1:6629920-6629942 GCCCAGGGGCTGCAGGTTCTGGG + Intronic
901491124 1:9596887-9596909 GTTCAGGTGCTCCAAGTACTGGG - Exonic
903904853 1:26677771-26677793 GCTCAAGTGCAGCTGGCCCTTGG - Intergenic
905008770 1:34732478-34732500 GCTCCAGAGCTGCAGCCACTAGG - Intronic
905357982 1:37398156-37398178 GCTCAGGTGATGCAGGAACCAGG - Intergenic
912553237 1:110497873-110497895 CCCCAAGGGGTGCAGGTACTAGG + Intergenic
915196589 1:154194282-154194304 TCTTAAGTGCTGCAGATGCTTGG + Intronic
917834830 1:178933187-178933209 GCTTTTGTGCTGCAGGTTCTGGG - Intergenic
1062810509 10:459928-459950 GCTCACGTGCAGCAGGTGGTTGG - Intronic
1066124744 10:32329747-32329769 GCTCCAATGCTAGAGGTACTTGG + Intronic
1067224364 10:44365871-44365893 GCTCATGTGCTGGAGCTGCTCGG - Intergenic
1071593581 10:86900628-86900650 GCTAAATTGCTGTATGTACTTGG - Intronic
1075202204 10:120414043-120414065 TCTCAAGTGCTATAGGCACTTGG + Intergenic
1076440887 10:130480767-130480789 GCCCAGGTGATCCAGGTACTGGG + Intergenic
1077440026 11:2563951-2563973 GCTGGAGTGCGGCAGATACTCGG + Intronic
1077684508 11:4278649-4278671 CCTCAGCTGCTGCAGGGACTCGG - Intergenic
1077685533 11:4288119-4288141 CCTCAGCTGCTGCAGGGACTCGG + Intergenic
1077689639 11:4329807-4329829 CCTCAGTTGCTGCAGGGACTCGG - Intergenic
1077690686 11:4339280-4339302 CCTCAGCTGCTGCAGGGACTCGG + Intergenic
1083269173 11:61562669-61562691 GGTCAAGCCCTGCAGGTCCTGGG - Intronic
1084290967 11:68167233-68167255 GCTTAACTGCTGAGGGTACTTGG + Intronic
1085144964 11:74186807-74186829 GCTCAAGAATTCCAGGTACTAGG + Intronic
1094350330 12:29517456-29517478 GCTGAAGTGCTGCAGCTTCCTGG + Exonic
1095244021 12:39897595-39897617 GCTCAAGAGCTGCATGTGGTTGG - Intronic
1095533112 12:43214083-43214105 GCCCAAGTGCTGGAGGTGCCAGG - Intergenic
1097703606 12:62845601-62845623 CCTCAAGTGCTGCTGTTCCTTGG + Intronic
1099256963 12:80326098-80326120 CCTCAAGTACTGCAGGTATAAGG - Intronic
1101672540 12:106889482-106889504 GCTGAAGAGCAGCAGGAACTAGG + Intergenic
1102146463 12:110658509-110658531 CCTCCAATGCTGCAGGTCCTTGG + Intronic
1102925673 12:116824216-116824238 GCTCTAATGCTGAAGATACTAGG - Intronic
1103716816 12:122949897-122949919 GCTCATTTGCCGCAGGTATTCGG - Exonic
1104071895 12:125353157-125353179 GCTGAAGTGCTGCAGTTGATTGG - Intronic
1104071900 12:125353205-125353227 GCTGAAGTGCTGCAGTTGATTGG - Intronic
1104071905 12:125353253-125353275 GCTGAAGTGCTGCAGTTGATTGG - Intronic
1113891178 13:113736351-113736373 ACTCCAGTGCTGCTGCTACTGGG - Exonic
1116883969 14:50200611-50200633 GCTCAAGTGATCCACCTACTTGG - Intronic
1119924701 14:78481935-78481957 GCTCAAGTGATTCAGGCTCTTGG - Intronic
1120393240 14:83934985-83935007 GCTCAAGTGCTACAGATTGTTGG + Intergenic
1128366156 15:67004849-67004871 GCTTCAGTGCTGCAGGCACCAGG - Intergenic
1133490974 16:6267642-6267664 GCTTCAGTGTTGCAGATACTAGG + Intronic
1141461539 16:84181085-84181107 GCTGGAGTGCCCCAGGTACTGGG + Exonic
1142126169 16:88411708-88411730 GCCCAAGTGCTGCAGGGCCTGGG + Intergenic
1144543971 17:16175132-16175154 CCTCAAGTGATGCACTTACTCGG - Intronic
1148775864 17:50095485-50095507 GCTGAAGTGCTCTATGTACTTGG - Exonic
1151550471 17:74819802-74819824 GGTCAGGATCTGCAGGTACTTGG - Exonic
1153228458 18:2915088-2915110 GCTCAAGAGCTGCAGGGGCAGGG + Exonic
1154157241 18:11953378-11953400 AGTCAAGTGCAGCAGGTCCTTGG - Intergenic
1154337039 18:13474318-13474340 GCCCAAGGGCTGCAGGGGCTGGG - Intronic
1162699238 19:12501281-12501303 GCTCAAGTGATCCATGTAGTGGG - Intronic
1163713378 19:18860214-18860236 GCTACAGTGCTGCAGGTCCTGGG - Intronic
926611447 2:14952169-14952191 GCTAAGGTGCTGCTGCTACTGGG - Intergenic
928435309 2:31251110-31251132 GCCCAAGTGGTGCAGGCCCTTGG + Intronic
929601770 2:43208965-43208987 GTCCAAGTCCTGCAGGAACTTGG + Intergenic
934569263 2:95358274-95358296 GCTGAAATGCACCAGGTACTGGG - Intronic
938735789 2:134185601-134185623 GCTTAACTGATTCAGGTACTGGG + Intronic
946285273 2:218697987-218698009 GCCCATCTGCTGCAGGTACTTGG + Exonic
948809105 2:240465925-240465947 GATCAGGTGCTGCTGGTCCTGGG + Intronic
1170199105 20:13723270-13723292 GGGCAAGTGATGCAGGAACTTGG - Intronic
1170596575 20:17810367-17810389 GCTCCAGTGCTGCAGACTCTGGG - Intergenic
1170671809 20:18441141-18441163 AGTCAAGTGCAGCAGTTACTTGG + Intronic
1172426447 20:34859504-34859526 GCTGAGGTGCTGGATGTACTTGG - Exonic
1172751094 20:37251865-37251887 GCTCAACTGCTGCAAATACCAGG - Intronic
1174697785 20:52578086-52578108 GCTATAATGCTGCAGGTCCTTGG - Intergenic
1175264239 20:57692857-57692879 GCCTAAGTGCTGCTGGTAATAGG + Intronic
1177174693 21:17690956-17690978 GCTCAAGTGCAACAGGAATTTGG - Intergenic
1177587754 21:23120192-23120214 CCTCCAGTGTTGCAGGTACTGGG + Intergenic
1180188850 21:46153292-46153314 GCTCAGGTGCTGCTGCTCCTGGG - Intronic
1185095736 22:48805041-48805063 GCTGGAGAGCTGCATGTACTTGG - Intronic
950487743 3:13282926-13282948 GGTCAGCTCCTGCAGGTACTCGG + Intergenic
950756714 3:15179142-15179164 GCTCCAGTCCTGCAGCCACTTGG - Intergenic
960530571 3:118759472-118759494 TTTCAAATGCTGCAGGTGCTGGG - Intergenic
960615995 3:119596602-119596624 GCTCAAGTGCTGCTGCAACCAGG - Intergenic
967983233 3:195077914-195077936 GCTCCAGGGCTGCAGATGCTGGG - Intronic
973969922 4:56203287-56203309 GCACAAGTGCTCCAGGTGGTCGG - Intronic
978645854 4:110930546-110930568 GTTCAAATGCTGCAGTGACTGGG - Intergenic
985165607 4:187091071-187091093 GCTCCAGAGCTGGAGGTGCTGGG - Intergenic
988837322 5:35046141-35046163 GCTCAAGATCTCTAGGTACTAGG + Intronic
994454907 5:99993588-99993610 GCTAAAGTGCTACAGGAAATTGG - Intergenic
994542709 5:101120980-101121002 GCTCATGGGCTGAAGGAACTTGG - Intergenic
995029478 5:107464194-107464216 GCTGAAGTGCTGCTGGTCCCGGG - Intronic
998522744 5:142815686-142815708 GCAAAAGTGCTCCAGGTCCTGGG - Intronic
998864233 5:146479405-146479427 TATCTAGTGCTGAAGGTACTAGG + Intronic
999783307 5:154868799-154868821 ACTTGAGTGCTGCAGCTACTGGG + Intronic
1003207271 6:4024241-4024263 GCTCAAGTGCTGCAGGTACTAGG + Intronic
1011597967 6:89034344-89034366 GTTCAAGTGATTCAAGTACTGGG - Intergenic
1012474801 6:99606988-99607010 GCTCGGGTGCTCCAGGTCCTTGG - Exonic
1013642466 6:112099366-112099388 GCTCCAGTGCTGCCTGTAATGGG + Exonic
1017761910 6:157575664-157575686 GCTCAAATGCTGCTGCTTCTGGG + Intronic
1018020165 6:159755165-159755187 GCTGTAGTCCTGCTGGTACTTGG - Exonic
1018622382 6:165742913-165742935 GAGCAAGTGCTGCAAGTGCTGGG - Intronic
1019443137 7:1057416-1057438 CCAGAAGTGCTGCAGGTACAGGG - Intronic
1020444060 7:8249855-8249877 TCTGAAGTGATGCAGGTATTTGG + Intronic
1021236759 7:18152074-18152096 GCACAAGTGCTACAGGAATTAGG - Intronic
1022127451 7:27372175-27372197 GCTCAAGTTCTGCAGGCTGTAGG + Intergenic
1024015692 7:45312200-45312222 GCCCCAGTGCTGAAGGTAGTGGG + Intergenic
1028394461 7:90352130-90352152 GCTCATGTGGTGCAGGTACTAGG + Intronic
1032845467 7:135748178-135748200 GCCCAACTGCTGCAGGTGGTGGG + Intronic
1034457049 7:151176229-151176251 GCTCAAATGCTGCAGCGACCTGG + Exonic
1036103919 8:5819137-5819159 GCTCGGGGGCTGCTGGTACTAGG + Intergenic
1037688186 8:21161519-21161541 GCTAAGATGCTGCATGTACTAGG + Intergenic
1039038942 8:33388698-33388720 GATCCCGTGCTGCAGGTGCTGGG - Intronic
1041092688 8:54317470-54317492 GCTCTAGTGCTGATGGTAGTTGG + Intergenic
1041495537 8:58481776-58481798 GAACAAATGCTGTAGGTACTGGG + Intergenic
1049799262 8:144510238-144510260 GTTCCAGAGCTGCAGATACTGGG - Intronic
1052914929 9:33917640-33917662 TCACAAGTGCTGCATATACTGGG + Exonic
1054805003 9:69389168-69389190 GCTTCATTGCTGCAGGTAGTGGG + Intronic
1055781816 9:79828934-79828956 GCACTAGTGGTGCAGTTACTGGG - Intergenic
1055829248 9:80359884-80359906 GCTCAAGTGGTGAAGGCAGTGGG + Intergenic
1060933126 9:127501192-127501214 CCTCAAATTCTGCAGGTACAGGG + Intronic
1061890362 9:133616028-133616050 GCTCAAATGTTGCAGCTTCTGGG + Intergenic
1185999633 X:4993963-4993985 ACTCAAGTTCTGCAGGAACATGG + Intergenic
1188558351 X:31438154-31438176 GTTCAAGTGCTGCAGGATCATGG - Intronic
1188630970 X:32359582-32359604 GCTGAAGTGCTGGAGGTTTTAGG - Intronic
1189381871 X:40507809-40507831 GCTCGAGGGCTGCAGGCTCTGGG - Intergenic
1189468887 X:41298973-41298995 GTGCAAGTGCTGGAGCTACTGGG + Intergenic
1190021947 X:46886559-46886581 AGTGAAGTGTTGCAGGTACTTGG - Intergenic
1192162935 X:68802270-68802292 TCCAAAGTGCTTCAGGTACTGGG + Intergenic