ID: 1003209085

View in Genome Browser
Species Human (GRCh38)
Location 6:4043456-4043478
Sequence TCTGCTGCAGACCCCACTGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 254
Summary {0: 1, 1: 0, 2: 1, 3: 24, 4: 228}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1003209085_1003209089 14 Left 1003209085 6:4043456-4043478 CCATCAGTGGGGTCTGCAGCAGA 0: 1
1: 0
2: 1
3: 24
4: 228
Right 1003209089 6:4043493-4043515 ACGTTAATATTTCTACAGTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1003209085 Original CRISPR TCTGCTGCAGACCCCACTGA TGG (reversed) Intronic