ID: 1003209089

View in Genome Browser
Species Human (GRCh38)
Location 6:4043493-4043515
Sequence ACGTTAATATTTCTACAGTG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1003209086_1003209089 -9 Left 1003209086 6:4043479-4043501 CCCCATAATCAAACACGTTAATA 0: 1
1: 3
2: 9
3: 30
4: 244
Right 1003209089 6:4043493-4043515 ACGTTAATATTTCTACAGTGAGG No data
1003209085_1003209089 14 Left 1003209085 6:4043456-4043478 CCATCAGTGGGGTCTGCAGCAGA 0: 1
1: 0
2: 1
3: 24
4: 228
Right 1003209089 6:4043493-4043515 ACGTTAATATTTCTACAGTGAGG No data
1003209087_1003209089 -10 Left 1003209087 6:4043480-4043502 CCCATAATCAAACACGTTAATAT No data
Right 1003209089 6:4043493-4043515 ACGTTAATATTTCTACAGTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1003209089 Original CRISPR ACGTTAATATTTCTACAGTG AGG Intronic