ID: 1003209089 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 6:4043493-4043515 |
| Sequence | ACGTTAATATTTCTACAGTG AGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 3 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1003209086_1003209089 | -9 | Left | 1003209086 | 6:4043479-4043501 | CCCCATAATCAAACACGTTAATA | 0: 1 1: 3 2: 9 3: 30 4: 244 |
||
| Right | 1003209089 | 6:4043493-4043515 | ACGTTAATATTTCTACAGTGAGG | No data | ||||
| 1003209085_1003209089 | 14 | Left | 1003209085 | 6:4043456-4043478 | CCATCAGTGGGGTCTGCAGCAGA | 0: 1 1: 0 2: 1 3: 24 4: 228 |
||
| Right | 1003209089 | 6:4043493-4043515 | ACGTTAATATTTCTACAGTGAGG | No data | ||||
| 1003209087_1003209089 | -10 | Left | 1003209087 | 6:4043480-4043502 | CCCATAATCAAACACGTTAATAT | No data | ||
| Right | 1003209089 | 6:4043493-4043515 | ACGTTAATATTTCTACAGTGAGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1003209089 | Original CRISPR | ACGTTAATATTTCTACAGTG AGG | Intronic | ||