ID: 1003212310

View in Genome Browser
Species Human (GRCh38)
Location 6:4079044-4079066
Sequence CGAAGCCCGCGGGCCGGCGC AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 226
Summary {0: 1, 1: 0, 2: 3, 3: 25, 4: 197}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1003212301_1003212310 12 Left 1003212301 6:4079009-4079031 CCTTGAGCGCAGCCCGGTCGGCA 0: 1
1: 0
2: 0
3: 1
4: 46
Right 1003212310 6:4079044-4079066 CGAAGCCCGCGGGCCGGCGCAGG 0: 1
1: 0
2: 3
3: 25
4: 197
1003212304_1003212310 0 Left 1003212304 6:4079021-4079043 CCCGGTCGGCAGTGCAGGGCCTG 0: 1
1: 0
2: 2
3: 24
4: 241
Right 1003212310 6:4079044-4079066 CGAAGCCCGCGGGCCGGCGCAGG 0: 1
1: 0
2: 3
3: 25
4: 197
1003212305_1003212310 -1 Left 1003212305 6:4079022-4079044 CCGGTCGGCAGTGCAGGGCCTGC 0: 1
1: 0
2: 0
3: 18
4: 160
Right 1003212310 6:4079044-4079066 CGAAGCCCGCGGGCCGGCGCAGG 0: 1
1: 0
2: 3
3: 25
4: 197

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1003212310 Original CRISPR CGAAGCCCGCGGGCCGGCGC AGG Exonic
900237632 1:1600211-1600233 CGTAGGCCGCGGCCCGGCGAGGG - Intergenic
900485317 1:2920012-2920034 CAAAGCCCTCGGGACGGCGGCGG + Intergenic
901058662 1:6461517-6461539 CGAGGCCCGCGGGCTGCTGCTGG + Exonic
901086553 1:6614748-6614770 CAAAGCCCGCGGGCGGGGGGCGG - Intronic
903034492 1:20485474-20485496 AGCAGCCCGCGGGCCGTCCCCGG - Exonic
903652498 1:24930311-24930333 CGGGGCCCGCGGGGCGGGGCTGG + Intronic
903811075 1:26035401-26035423 CGGAGCCCGCCGGCAGGCGCCGG - Exonic
903919256 1:26787938-26787960 CGGAGCCAGCGCGCAGGCGCGGG + Intronic
904093323 1:27959960-27959982 CGCAGCCCTCGGGGCGGCCCGGG - Exonic
904563391 1:31413318-31413340 CGGCGCGCGCGGGCGGGCGCCGG - Intronic
905037996 1:34929815-34929837 CGCCGCCCGCGGGCGGCCGCCGG + Intergenic
905819731 1:40980031-40980053 CGAGGCCCGCGCGCGGGAGCCGG - Intronic
906525220 1:46489766-46489788 GGAAGCGCCCGGGCCCGCGCCGG + Intergenic
907136183 1:52141914-52141936 CGTAGCCCGCGGCCCGCGGCCGG - Intergenic
910163402 1:84298434-84298456 CGACCCCCGCCGACCGGCGCTGG + Exonic
912492622 1:110070473-110070495 CGCGGGCCGCGGGGCGGCGCGGG + Exonic
912776558 1:112509348-112509370 CGAAGCCCGGGAGCCGTCGGGGG - Exonic
912931166 1:113963476-113963498 CGCAGCCGGCCGGCCGGCGCTGG + Exonic
914824691 1:151132600-151132622 GGTAGCCCTCGGGCCGGCCCAGG + Exonic
915165697 1:153946642-153946664 CGGCGCCCGCGGCCCGGAGCGGG - Exonic
915302993 1:154962051-154962073 GGTAGCCCGGGGGCCGGTGCTGG + Intronic
915559224 1:156676759-156676781 GGAGGCCCGCGGGGCGGCGCGGG + Exonic
916144448 1:161726743-161726765 GGAGGCCCGCGGCGCGGCGCTGG + Exonic
918497676 1:185157552-185157574 CGGAGCCCGCGGGCCCGCGGCGG + Intronic
920184594 1:204152087-204152109 AGCGGCCCGCGGGCCGGGGCGGG - Intergenic
922196628 1:223364666-223364688 CCCAGCCCGCGGCGCGGCGCGGG + Intergenic
922753644 1:228082547-228082569 CTAAGACCGCGGCCCGGGGCAGG + Intergenic
923161360 1:231317492-231317514 CGGCGCCCGCGGGCCGGCACGGG + Intergenic
923684137 1:236142389-236142411 CGGGGCGCGCGGGCCGGGGCGGG + Intergenic
924957687 1:248945017-248945039 CAAAGGCGGCGCGCCGGCGCAGG - Intergenic
1062843901 10:690034-690056 CGGGGCCCGCGGGGCGGGGCGGG + Intergenic
1065390085 10:25174585-25174607 CGCCGCCCGCGGGCCGCCTCGGG + Intergenic
1069664610 10:70146213-70146235 GGACGCCCGCGGGACGGGGCAGG + Exonic
1072071654 10:91923921-91923943 AGATGCCCGAGGGCCTGCGCTGG + Exonic
1075573793 10:123563734-123563756 AGAAGCCCCAGGGCCAGCGCTGG + Intergenic
1075877858 10:125822971-125822993 CGAAGCCCGCGGGCGTGCAGGGG - Intronic
1076963535 10:133786531-133786553 CAAAGGCGGCGCGCCGGCGCAGG - Intergenic
1077213006 11:1382194-1382216 GGAAGCCCCCGGGCTGGGGCAGG + Intergenic
1078180282 11:9004695-9004717 GGAAGCCCGCGGGTGGGCGTGGG + Intergenic
1083912924 11:65720528-65720550 AGAAGCGCGCAGGCCGGCGCGGG + Intronic
1083997124 11:66278167-66278189 CGAAGCCGGCGGGGCGGAGCCGG - Intergenic
1084336501 11:68460876-68460898 CGAGGCGCGCGGGCAGGCGCGGG + Intronic
1084438421 11:69157254-69157276 CGGAGACCGTGGGCCGGCGCTGG + Intergenic
1085784798 11:79440070-79440092 AGGAGCCCGCGAGGCGGCGCCGG - Intronic
1087118113 11:94544987-94545009 CCAGGCCCCCGGGCCAGCGCTGG + Exonic
1087141442 11:94768897-94768919 CGAGACCCGCGCGCGGGCGCGGG - Intronic
1091372988 11:135076366-135076388 CAAAGCCGCCGCGCCGGCGCAGG - Intergenic
1091460937 12:643041-643063 CGTAGCCCGCGGGCCGACTCGGG - Intronic
1091498396 12:991560-991582 TGGAGCCCGCGGGTGGGCGCCGG - Intronic
1091718336 12:2795313-2795335 CGGAGCCCGCGGCCGGGCACGGG + Intronic
1092999676 12:13982255-13982277 CGCAGCCCGCGGGCCGCCCACGG - Intergenic
1095465513 12:42484104-42484126 CGCCGCCCGCGGGCGGGAGCGGG - Intronic
1096622654 12:52874238-52874260 GGAAGCCCGCGGGGCGCGGCGGG + Intergenic
1097850240 12:64404363-64404385 GGCAGCCCGCGGGCTGACGCCGG - Exonic
1105277475 13:18944276-18944298 CGAACCCCCGGGCCCGGCGCAGG + Intergenic
1105472081 13:20703763-20703785 GGGGGCGCGCGGGCCGGCGCCGG + Intronic
1105768070 13:23579890-23579912 CGCAGGACGCGGGCGGGCGCCGG - Intronic
1106248364 13:27966908-27966930 CGCAGCCCGCGGGCCGGAGCCGG - Intronic
1112088209 13:96053535-96053557 CGGAGCCGCCGGGGCGGCGCCGG + Intergenic
1113541792 13:111115190-111115212 CGCAGGGCGCGGGGCGGCGCGGG + Intronic
1113942814 13:114027206-114027228 CGAGCCCCGCCGGCCGGCCCTGG - Intronic
1113989971 13:114353410-114353432 CAAAGGCGGCGCGCCGGCGCAGG - Intergenic
1116018352 14:39432557-39432579 CGCAGGCCGCGGGGCGGGGCGGG + Intergenic
1116437568 14:44912201-44912223 CGGTGCTCACGGGCCGGCGCCGG + Intergenic
1117722031 14:58637878-58637900 CGCAGCCGAGGGGCCGGCGCGGG + Intronic
1121279167 14:92687319-92687341 CGACGCCTGCGGGCTGGGGCTGG - Intronic
1122629396 14:103100392-103100414 CAAAGCCCGCTGGCTGGCCCGGG - Exonic
1122719872 14:103716027-103716049 GGAAGCCCGCGGGGCCGGGCCGG - Intronic
1122904484 14:104795550-104795572 GCATCCCCGCGGGCCGGCGCTGG + Intronic
1125328938 15:38564289-38564311 GGAAGTCGGCGGGCGGGCGCCGG + Intronic
1125834253 15:42736476-42736498 CCACGCTCGCGGGCCGGCCCCGG + Exonic
1128482813 15:68054513-68054535 CGGGGCCCGCGGCCCGCCGCAGG - Intronic
1129333178 15:74838170-74838192 CGGAGCCCCCGGGCCGGAGGCGG - Exonic
1130115219 15:81000673-81000695 CAGAGCCCCCGGGCCGGAGCAGG + Intergenic
1131827877 15:96334445-96334467 CGAAGCATGCAGGCCGGCGGCGG - Exonic
1131888622 15:96947920-96947942 CCGAGGACGCGGGCCGGCGCGGG - Intergenic
1132609343 16:807525-807547 CGAGCCCCGCGTGCAGGCGCCGG + Exonic
1132756420 16:1487544-1487566 TGCAGCCCTCGGGCCGGCCCTGG - Exonic
1133156711 16:3880914-3880936 GGAAGCTGGCGGCCCGGCGCGGG + Intergenic
1133292855 16:4734299-4734321 GGAAGCTCGCGGGTCGGCACCGG + Exonic
1135115211 16:19718120-19718142 CGTTGCAGGCGGGCCGGCGCGGG - Exonic
1137280582 16:46973388-46973410 GGCTGCCCGCGAGCCGGCGCCGG - Intronic
1137394867 16:48109787-48109809 CGCAGCCCGCAGGCTGGGGCAGG + Intronic
1139088547 16:63617463-63617485 CGGCGCTCGCGGGCCGGCACGGG - Intergenic
1141665435 16:85463060-85463082 CGCGGCCCGGGGGGCGGCGCAGG + Intergenic
1142199597 16:88754751-88754773 CGGGGCCCGCAGGCCAGCGCTGG + Intronic
1142210756 16:88807368-88807390 CGCAGCACGCGGGCCAGCTCAGG - Exonic
1142429715 16:90019481-90019503 AGGAGCCCGCGGGGCGGGGCGGG + Intronic
1142880407 17:2878968-2878990 CTGAGCCCGGAGGCCGGCGCTGG + Intronic
1143697538 17:8631116-8631138 CGCAGCGCGCCGGCCGCCGCGGG - Intergenic
1144695879 17:17303597-17303619 CGGTTCCCGCGGGGCGGCGCGGG + Exonic
1145751410 17:27357484-27357506 CGAAGCCCACGGTCTGGCGGGGG - Intergenic
1146912565 17:36658048-36658070 CCAAGGCCCCGGGCCGGTGCGGG + Intergenic
1148664248 17:49362385-49362407 CGCAGCCCTCGGGCCGGCCCGGG + Intronic
1149491023 17:57085344-57085366 CGGAGTCCGCGCGCCGCCGCCGG - Intronic
1151812553 17:76453033-76453055 CGCAGCCCCCGTCCCGGCGCCGG - Exonic
1152782199 17:82231410-82231432 CGACGCCCGCTGGGCGGCGGTGG + Intronic
1153382602 18:4455378-4455400 CGGAGCCGGCGGGCGGGCGGCGG + Intergenic
1153688395 18:7567918-7567940 CGAGGCGCGCGGGCCGGCGCGGG + Intronic
1156119098 18:33820561-33820583 CGGCGCTCCCGGGCCGGCGCGGG - Intergenic
1160739639 19:680008-680030 CGGTGCGCGCGGGCCGGGGCGGG - Intronic
1160772078 19:836771-836793 CGGGGCCCGCGGGACGGTGCTGG + Intergenic
1160812972 19:1020914-1020936 CGAGGCCCGCGCGCGGGGGCCGG + Exonic
1161251829 19:3284971-3284993 GGCAGCCCGCGTGCCCGCGCTGG + Intronic
1161400247 19:4064135-4064157 AGAGGCCCGCGGGCGGCCGCAGG - Intronic
1161443314 19:4304706-4304728 CGGGGCCCGCGGGCCGGGCCGGG + Exonic
1162020223 19:7864840-7864862 CGAAGCCTGGGGACCGGGGCAGG + Intronic
1163413685 19:17172680-17172702 CAAAGACCCCGGGCTGGCGCAGG - Intronic
1163695694 19:18762206-18762228 CGCAGCTCCCGGGCGGGCGCTGG - Intronic
1164639314 19:29812515-29812537 TGAGGCCTGCGGGGCGGCGCGGG - Exonic
1165135758 19:33667362-33667384 CGCAGCCCGACGGCTGGCGCTGG + Intronic
1165204612 19:34172821-34172843 AGGAGGCCGCGGGCCGGAGCGGG - Intronic
1165349607 19:35268822-35268844 CGGAGCCGGCGGGCGGGCGGAGG + Intergenic
1167284094 19:48589111-48589133 GGAAGCCCGAGAGGCGGCGCTGG + Intronic
1167347424 19:48955203-48955225 CCAAGCCCCCGGGCAGGCCCGGG + Intronic
1167425717 19:49428741-49428763 CGACCCCCGCGGGGCGGCGGGGG - Exonic
1168286992 19:55340101-55340123 CGGAGCCCGAGGCCCGGCGAGGG - Intronic
1168581635 19:57559897-57559919 AGAAGGCAGTGGGCCGGCGCAGG - Intergenic
926035241 2:9630911-9630933 GGAAGCCCGCGGGCCGACCCAGG + Intronic
928793838 2:34992082-34992104 CGGCGCTCGCGGGCCAGCGCGGG + Intergenic
929460859 2:42101359-42101381 CGAGGCCCGCGCGGCGCCGCAGG + Intergenic
932496566 2:72148576-72148598 CGGAGCCGGCGGGCCGCGGCCGG + Intergenic
934846370 2:97663704-97663726 CGAAGCCAGCGGCCCGGCGGGGG + Intronic
935046677 2:99489657-99489679 GGACGGCCGCGGGCCGGGGCCGG + Intronic
935645318 2:105329644-105329666 CCCAGGCCGCGGGGCGGCGCGGG - Exonic
936396995 2:112138705-112138727 GGAAGCCCGCGGCTCGGGGCAGG - Exonic
938422284 2:131154961-131154983 CGAGGCCCGCAGGCGGGCTCAGG + Intronic
938796186 2:134719389-134719411 CGAAGCCCGCGGCCGCGCGTGGG + Intergenic
940453806 2:153872148-153872170 CGGCGCTCGCGGGCCGGCGCGGG + Exonic
941951328 2:171160252-171160274 GGAGGCCCGCGAGCGGGCGCGGG + Intronic
945080841 2:206085439-206085461 GAAAGCCTCCGGGCCGGCGCGGG + Intronic
945189024 2:207166922-207166944 CGGCGCCCGCGGGGCGGGGCGGG - Intronic
946416850 2:219544062-219544084 CAAAGGCCGCGGGCGGGCTCAGG + Intronic
948487207 2:238288583-238288605 CGAGGCCCGCGCGCCGGCGGCGG + Exonic
1168790826 20:574658-574680 TGAAGCCAGCGGGCCGGCAAAGG - Intergenic
1168965224 20:1894683-1894705 CGGGGCCCGGGCGCCGGCGCGGG + Intronic
1171036229 20:21714682-21714704 TGCACCCCGCGGGCCGGCACTGG - Exonic
1171972544 20:31573210-31573232 CGGCCCCCGCGGGGCGGCGCGGG - Intronic
1172274980 20:33674443-33674465 CTGAGCCCGCGCGTCGGCGCCGG - Intronic
1172547326 20:35772097-35772119 CGAAGCCGGCCGGCCGGGCCGGG + Intronic
1172618695 20:36306382-36306404 GGGCGCCCGCGGGCCGGAGCCGG + Exonic
1175074028 20:56358891-56358913 CGAAGCCGGCGGGCGGGGCCGGG + Intergenic
1176125351 20:63472511-63472533 CGGAGCGCGGGGGGCGGCGCGGG + Exonic
1176173666 20:63707817-63707839 CGAGGCCCGAGGGGCGGCCCAGG - Intronic
1176194524 20:63831132-63831154 CGCGGCCGCCGGGCCGGCGCCGG + Intronic
1176242085 20:64079898-64079920 TGGAGCGCGCGGGCCGGCGGCGG - Intronic
1176547824 21:8209078-8209100 CGAGCCCCGCCGGCGGGCGCGGG - Intergenic
1176574651 21:8436313-8436335 CGAGCCCCGCCGGCGGGCGCGGG - Intergenic
1176611264 21:8987605-8987627 CGAGCCCCGCCGGCGGGCGCGGG - Intergenic
1178610405 21:34074050-34074072 GGACTCCCGCGGGCCGGCGCCGG - Intronic
1179512012 21:41879381-41879403 TGTAGTCCGCGGGCGGGCGCGGG + Exonic
1179522529 21:41954180-41954202 CGCGGCCCGCGGGCAGGCGCCGG - Intergenic
1179882851 21:44300586-44300608 GGAAGCCCGCAGCCTGGCGCCGG - Intronic
1183780380 22:39995315-39995337 CAAGGCCCCCGCGCCGGCGCCGG + Exonic
1184276576 22:43412244-43412266 CGACGCCCGCGGCGCTGCGCAGG + Intronic
1184671451 22:46014031-46014053 CGGAGCCCGCCGGCTGCCGCAGG - Intergenic
1184724598 22:46336110-46336132 AGAAGCCGGCGGGCCGGGGTGGG + Intronic
1184796888 22:46738021-46738043 CGGAGCCCGGGGCCCGGAGCCGG - Exonic
1185430382 22:50807256-50807278 CAAAGGCGGCGCGCCGGCGCAGG - Intergenic
1203252698 22_KI270733v1_random:125363-125385 CGAGCCCCGCCGGCGGGCGCGGG - Intergenic
1203260755 22_KI270733v1_random:170450-170472 CGAGCCCCGCCGGCGGGCGCGGG - Intergenic
950583915 3:13879855-13879877 CTGATCCCGCGGGCCGGCCCCGG + Exonic
954186193 3:48918887-48918909 CGGAGGCGGCGGGCCGACGCCGG - Exonic
954618600 3:51983272-51983294 CGCAACTCGCGGGGCGGCGCTGG + Exonic
959085921 3:101850116-101850138 CGAGGCCCGCGGGAGGGAGCCGG - Intronic
961825514 3:129597200-129597222 TGGAGCCCGCAGGCCTGCGCTGG - Intronic
962520739 3:136195839-136195861 GGAAGTGCGCGGGCCGCCGCCGG + Exonic
963904626 3:150763244-150763266 CGGAGCCAGCGCCCCGGCGCAGG - Exonic
968550091 4:1217624-1217646 CTAAAGCCGCGGGCCGGCGCCGG + Intronic
969597797 4:8158771-8158793 CGGAGCCGGCGGGCGGGCGGAGG - Intronic
972817177 4:42657139-42657161 CGGAGCTCGGGCGCCGGCGCCGG + Intergenic
974047347 4:56908612-56908634 GGAGGGCCGCGGGCCGGCGCGGG - Intronic
975984301 4:80188876-80188898 CGAAGCCAGCGTGCGGGCGCTGG + Intronic
976297326 4:83485171-83485193 AGCAGCCCGTGCGCCGGCGCAGG - Exonic
978154569 4:105474143-105474165 CGCAGCCCGAGCGCCGGGGCGGG - Intergenic
978490089 4:109302873-109302895 CCCAGCCCGCGGGCCGGCCCGGG + Intergenic
984811139 4:183797499-183797521 CGCAGCCCGCGGGTCGCTGCGGG - Intergenic
984811277 4:183798018-183798040 GGAAGCCCGAGGGCGGCCGCAGG - Intergenic
985466789 4:190203974-190203996 CAAAGGCGGCGCGCCGGCGCAGG - Intergenic
986721493 5:10564001-10564023 CCCATCCCGCGGGCCGGCGGAGG + Intergenic
1001382261 5:171312395-171312417 CGAAGGCCGCGGGCCAGCGCCGG + Intergenic
1001556549 5:172641190-172641212 CGGAGCCGGCGGGCCCGGGCCGG + Intergenic
1001993269 5:176134450-176134472 AGAAGCCAGGGGGCCTGCGCTGG + Intergenic
1002487665 5:179550690-179550712 CGAAGCCAGCTGCCCGGCCCAGG + Exonic
1002700688 5:181122447-181122469 CGGAGCACGGGGGCCGGCGGGGG - Intergenic
1002927832 6:1615004-1615026 TGGAGGCTGCGGGCCGGCGCGGG - Intergenic
1003212310 6:4079044-4079066 CGAAGCCCGCGGGCCGGCGCAGG + Exonic
1003425731 6:5997155-5997177 CGAAGCCCGCCGCCCGCTGCGGG - Intergenic
1004203896 6:13574318-13574340 CGGAGACCCCGGCCCGGCGCAGG - Intergenic
1006369198 6:33633785-33633807 CGGAGCTCGCGGGCCGGGCCAGG + Intronic
1006617961 6:35342635-35342657 CGGAGCCTGCGGGACGGCGGCGG + Exonic
1007785264 6:44276189-44276211 GCCAGCCCGCGGGCCGGCCCGGG + Exonic
1007788892 6:44297691-44297713 AGAGTCCCGCGCGCCGGCGCAGG + Intronic
1012401411 6:98845241-98845263 CGGGGCCCGCGGGGCGGGGCGGG - Intergenic
1017021455 6:150143262-150143284 CAAAGCCCCCGGGGTGGCGCCGG + Exonic
1018686439 6:166307848-166307870 CGGAGCCTGCCGGCCGGGGCGGG + Exonic
1019147362 6:169983921-169983943 CGAAGCCCTCTGGCTGGCACGGG - Intergenic
1020002256 7:4762563-4762585 CGATGCCCACAGGCCGCCGCGGG - Exonic
1020278252 7:6637382-6637404 CGGGGCCTGCGGGCCGGCGGCGG - Exonic
1022108622 7:27214119-27214141 AGAAGCCCTCGGGCAGGCGCCGG - Intergenic
1022396004 7:29989072-29989094 CGACGCGCGCGGGCCGCCCCTGG - Intronic
1026941285 7:74289421-74289443 CGGAGCCAGCGGCCCGGCTCCGG - Intergenic
1029737443 7:102472627-102472649 GGAAGCCCGCGGGATGGGGCGGG - Intronic
1031484324 7:122310226-122310248 CAAGGCCAGCGGGTCGGCGCGGG - Intronic
1031966765 7:128032522-128032544 CGGAGGGCGGGGGCCGGCGCGGG - Intronic
1032083173 7:128870007-128870029 CGAAGCCCCCGGCCCGGCGGCGG - Intronic
1034349729 7:150408070-150408092 CGAAGACGCCGGGGCGGCGCGGG - Intronic
1034522495 7:151631926-151631948 GGAAGCCCAGGGGCCGGGGCGGG - Intronic
1038726683 8:30088183-30088205 CACCGCTCGCGGGCCGGCGCAGG + Intergenic
1044819249 8:96144916-96144938 CGAAGGCCGTGCGCCGCCGCCGG + Exonic
1047454803 8:124998872-124998894 CGGGGGCTGCGGGCCGGCGCGGG - Exonic
1049109607 8:140635143-140635165 CGGGGCCCGCGGGCTGGGGCCGG - Intronic
1057432368 9:95005397-95005419 CGAGTTCCGCGGGCGGGCGCGGG + Intronic
1057995899 9:99821621-99821643 AGAAGCCCCCAGGCCGGGGCCGG + Intergenic
1060664422 9:125424273-125424295 CCAAGCCCTGGGGCCGGCACTGG + Intergenic
1061275808 9:129568926-129568948 CCAAGCCCGCTGGGCGGGGCGGG - Intergenic
1061764933 9:132875674-132875696 CGATGCCCGCAGGCAGGTGCAGG - Intronic
1203469102 Un_GL000220v1:108515-108537 CGAGCCCCGCCGGCGGGCGCGGG - Intergenic
1203476923 Un_GL000220v1:152487-152509 CGAGCCCCGCCGGCGGGCGCGGG - Intergenic
1185471538 X:386731-386753 CGAAGCCCCCGGGGCGGGGCGGG - Intronic
1192160582 X:68783588-68783610 AGAAGCCGGCGGGCCGGCGTTGG + Intergenic
1192847733 X:74924147-74924169 GGAAGGCCGTGAGCCGGCGCGGG - Intronic
1198005465 X:132489305-132489327 CACAGCCCGCCGGCCGGCCCCGG - Intronic
1199772643 X:150984155-150984177 CGGCGCCCGCGGCCCGGGGCGGG + Intronic
1201763432 Y:17560905-17560927 TGAAACCCTCGGCCCGGCGCAGG + Intergenic
1201838121 Y:18345085-18345107 TGAAACCCTCGGCCCGGCGCAGG - Intergenic