ID: 1003213976

View in Genome Browser
Species Human (GRCh38)
Location 6:4091954-4091976
Sequence TCGCTATGTTGAGGGAGTGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 176
Summary {0: 1, 1: 22, 2: 37, 3: 34, 4: 82}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1003213976 Original CRISPR TCGCTATGTTGAGGGAGTGC TGG (reversed) Intronic
902541148 1:17155860-17155882 TCCCTATGTTGAGGGAGTGCTGG + Intergenic
910636091 1:89409629-89409651 TTCCTATGTTGAGGGAGTGCTGG - Intergenic
912046961 1:105470882-105470904 TCCCTATGTTGAGGGAGTGCTGG + Intergenic
914927950 1:151905650-151905672 TCCTTTTGTTGAGGGAGTGCTGG - Intronic
915054964 1:153119856-153119878 TCCCTGTGTTGAAAGAGTGCTGG + Intergenic
915752738 1:158227358-158227380 TCCCTATGTTGAGGGAGTGCTGG - Intergenic
916527883 1:165628825-165628847 TCCCTATGTGGAGGGAGTGCTGG + Intergenic
921410512 1:214831648-214831670 TAGGTATGGTGAGGGAGTTCAGG - Intergenic
1065307020 10:24378846-24378868 TAGCTATGTTTAGGAAGTGAGGG + Intronic
1066352174 10:34646021-34646043 TCGCTATGTTTTGGGGGTTCTGG - Intronic
1068389132 10:56370462-56370484 TCCTAATGTTAAGGGAGTGCTGG - Intergenic
1070503908 10:77096455-77096477 TGGCTTTTTTGAGGGAGTGTGGG - Intronic
1071844484 10:89507165-89507187 TTGCTATGTTGGGGAAGTTCTGG - Intronic
1072876349 10:99176711-99176733 TTGCTAGGTTGAGGAAGTTCTGG - Intronic
1073927518 10:108534127-108534149 TCGCTATGTTGGGGAAGTTCTGG - Intergenic
1075161635 10:120029578-120029600 TCTCTCTGTTGAGGCAGGGCAGG - Intergenic
1077001109 11:322757-322779 TCCCTGTGTTAAGGGAGTGCTGG + Intronic
1079653866 11:22964457-22964479 TTGCTAGGTTGAGGAAGTTCTGG + Intergenic
1079816964 11:25073398-25073420 TCCCTGTGTGGAGGAAGTGCTGG + Intronic
1079966221 11:26983457-26983479 TTGCTAGGTTGAGGAAGTTCCGG + Intergenic
1081037981 11:38174082-38174104 TCCCTATGTTGAGGGAGTGCTGG + Intergenic
1082960885 11:58917796-58917818 TCCCTTTGTGGAGGGAATGCTGG + Intronic
1085861129 11:80237320-80237342 TAGCAATGTTGTGGGAGTTCAGG + Intergenic
1085861164 11:80237648-80237670 TAGCAATGTTGTGGGAGTTCAGG - Intergenic
1087032212 11:93717008-93717030 TCCCTATGTTGAAGGAGTGCTGG + Intronic
1087871257 11:103295458-103295480 TCCCTAAGTTGAGGGAGTGCTGG - Intronic
1090624555 11:128594642-128594664 TGGCTATGTTGAGGGAGTAAGGG - Intergenic
1092560903 12:9611901-9611923 TTGCTATGTTGGGGAAGTTCTGG - Intergenic
1094202787 12:27810344-27810366 GGGCTTTGGTGAGGGAGTGCAGG + Intergenic
1095855647 12:46857892-46857914 TCCCTATGTTGAGGGAGTGCTGG + Intergenic
1097138298 12:56878361-56878383 TCCCTATGTTGAGGGAGTGCTGG + Intergenic
1099799190 12:87435728-87435750 TTACTTTGTTGAGTGAGTGCTGG - Intergenic
1102053385 12:109879413-109879435 GGGCTAGGCTGAGGGAGTGCGGG + Intronic
1102068243 12:109996440-109996462 TCGCCATCTTGAGTGAGGGCAGG + Intergenic
1103380153 12:120487940-120487962 TCCCTATGTTGAGGGAGTACTGG + Intronic
1104630546 12:130397758-130397780 TCTCTGTCTCGAGGGAGTGCGGG + Exonic
1104722585 12:131053205-131053227 TCACTGTGATGACGGAGTGCAGG + Intronic
1105740739 13:23320557-23320579 ATGCTAAGTTGAGGGATTGCTGG + Intronic
1107914285 13:45133463-45133485 TCCCTATGTTGAGGGAGTGCTGG - Intronic
1108337790 13:49463826-49463848 TCTCTATGTTGAGGGAGTGCTGG + Intronic
1109404146 13:61875595-61875617 TCGCTATGTTGAGGGAATGCTGG + Intergenic
1109487402 13:63045043-63045065 TCCTTATGTTGAGGGAGTGCTGG + Intergenic
1109997975 13:70154684-70154706 TCTCTTTGTTGAGGGATTGCTGG - Intergenic
1113466333 13:110515981-110516003 TCGCTCTGTTGTGGGATTACAGG - Intergenic
1113772391 13:112918437-112918459 TCGGCAAGTTGAGGGTGTGCAGG + Intronic
1115632613 14:35260406-35260428 TCCTTATGTTGAGGGAGTACTGG - Intronic
1116395984 14:44449209-44449231 TCCTTATGTTGAGGGAGTGTTGG + Intergenic
1118693907 14:68365004-68365026 TAGCTTTGGTGAGGGAGTGAAGG + Intronic
1119424400 14:74526522-74526544 TGGCTATGTTGAGGGACACCAGG - Intronic
1120154837 14:81082107-81082129 TCCCTATGTTGAGGGAGTGCTGG - Intronic
1122647539 14:103205378-103205400 TCCTTATGTTGAGGGAGTGCTGG + Intergenic
1123218635 14:106836579-106836601 TCCTTATGTTGAGGGAGTGCTGG + Intergenic
1123220007 14:106845812-106845834 TCCTTATGCTGAGGGAGTGCTGG + Intergenic
1127627332 15:60793011-60793033 TCTCTCTTTTGAGGGAGTGGTGG - Intronic
1128600568 15:68992161-68992183 TCCTTATGTTGAGGGAGTGCTGG + Intronic
1129981769 15:79878709-79878731 TCCCTATGTGGAGGGAGTGGTGG + Intronic
1131053930 15:89364663-89364685 TTGGTGAGTTGAGGGAGTGCAGG + Intergenic
1135557011 16:23445625-23445647 TCGCTCTGTAGCTGGAGTGCAGG - Intronic
1137597654 16:49735496-49735518 TCGTTATGATGAGGGAGTCAAGG - Intronic
1139727917 16:68916822-68916844 AGGCTATGTTGTGTGAGTGCAGG - Intronic
1145355408 17:22142009-22142031 TCCCTATGTTGAGGGAGTGCTGG - Intergenic
1145361109 17:22213165-22213187 TCCCAATGTTGAGGGAGTGCTGG - Intergenic
1146283020 17:31557699-31557721 TCGCCATTTTGTGGGAGCGCAGG - Intergenic
1147601444 17:41748344-41748366 TCGATATGTTGAGGGCCTGAAGG + Intergenic
1150940654 17:69689850-69689872 TAGCAATGTTGAGAGACTGCAGG + Intergenic
1151831903 17:76557694-76557716 TCGCGATGTTGAGAAAGGGCTGG - Intergenic
1151923513 17:77175701-77175723 TCCCTGTGTTGAGGGAGTGCTGG + Intronic
1203165616 17_GL000205v2_random:90264-90286 TCCCTGTGTTGGGGGAGTGTTGG + Intergenic
1153904249 18:9646958-9646980 TGGCTATGGAGAGGGAGGGCTGG + Intergenic
1153992785 18:10414842-10414864 GCTCTATGATGAGGGAATGCTGG - Intergenic
1155732701 18:29180717-29180739 TCCGTATGTTGAGGGAATGCTGG + Intergenic
1155823518 18:30408708-30408730 TCCCTATGTTTAGGAAGTGCTGG - Intergenic
1156953358 18:42932124-42932146 TTTCTATCATGAGGGAGTGCTGG - Intronic
1159054777 18:63452762-63452784 TCCCTATGTTGAAGGAGTGCTGG - Intergenic
1163270093 19:16247876-16247898 TCGCTGTGTTCAGAGAGGGCTGG - Intergenic
1163367201 19:16881885-16881907 TCCCTATGTTGAGGGAGTGCTGG - Intergenic
1164044060 19:21519279-21519301 TCCCTATGTTGAGGGAATGCTGG - Intronic
1164404477 19:27931466-27931488 TCCCTATGTTGAGGGAGTGCTGG - Intergenic
1165638722 19:37365635-37365657 TCCTTATGTTGAGGGAGTGCTGG + Intronic
1166246812 19:41534199-41534221 TCCCTACATTGAAGGAGTGCTGG + Intergenic
1167002914 19:46756428-46756450 CCGCTATGTGGTGGGCGTGCTGG + Exonic
1167496281 19:49820597-49820619 TCTCTATGTTGAGGGAGTGCTGG + Intronic
926046079 2:9710673-9710695 TCGCTTTGTTGCCGAAGTGCTGG + Intergenic
927132717 2:20073982-20074004 TCCCTATGTTGAGGGAGGGCTGG - Intergenic
930016947 2:46977240-46977262 TATCTAAGTTGAGGGAGGGCAGG + Intronic
932651349 2:73561334-73561356 TCCCTGTGTTGAAGGAGTGCTGG + Intronic
933083890 2:78030079-78030101 TCCTTATGTTGTGGGAGTGCTGG + Intergenic
933532744 2:83531092-83531114 TCCCTCTGTAGAGGGAGTGCTGG - Intergenic
938224128 2:129601124-129601146 TTGCTAGGTTGAGGAAGTTCTGG + Intergenic
938251684 2:129820777-129820799 TCCCTGTGTTGAGGGAGTCCTGG + Intergenic
948723344 2:239917348-239917370 TCCCTATGTTGAGGGAGTGCTGG - Intronic
949052890 2:241906714-241906736 TCCCTATATTGAGGGAGTGCTGG + Intergenic
1168954531 20:1825860-1825882 TAGCTTTGTAGAGGGAGGGCAGG + Intergenic
1171333781 20:24364530-24364552 TAGCTTTGTTGAGGGAGGGAGGG + Intergenic
1173679081 20:44863619-44863641 TCCCTGTGTTGAGGGAGTGCTGG - Intergenic
1173943960 20:46935167-46935189 TTGCTATGTAGAGTGAGTGCAGG + Intronic
1175039414 20:56032861-56032883 TCCTTATGTTGAGGGAGTGCTGG + Intergenic
1176406138 21:6368815-6368837 TCCCTGTGTTGGGGGAGTGTTGG - Intergenic
1176687636 21:9865287-9865309 TCCCTATGTTGAGGGAGCCCTGG - Intergenic
1178677204 21:34641340-34641362 TTTCTATGTTGAGGGAGTGCTGG - Intergenic
1180894164 22:19316210-19316232 TCCTTATGTGGAGGGAGTGCTGG - Intergenic
1182455872 22:30450164-30450186 TGGCTATGTTGAGGTAGCGGGGG + Intronic
1185114312 22:48922778-48922800 TAGATATGTTCAGTGAGTGCTGG - Intergenic
953079513 3:39602743-39602765 TGGCTTTGTTGAGGGTGAGCAGG - Intergenic
953182905 3:40613211-40613233 ACGCTCTCTTGAGGGACTGCAGG - Intergenic
959961255 3:112302004-112302026 TCCCTGTGTTGAGGGGGTGCTGG - Intergenic
959962002 3:112308059-112308081 TCCCTGTGTTGAGGGAGTGCTGG - Intergenic
959962313 3:112312426-112312448 TCCTTATGTTGAGAGAGTGCTGG - Intergenic
961317765 3:126052264-126052286 ACCCTATGTGGAGGGTGTGCAGG - Intronic
964691648 3:159456301-159456323 TCTCTATGTTGAGGGAATGATGG + Intronic
965850194 3:173013860-173013882 TCCCTAGGTTGAGGGAGTGCTGG + Intronic
968692284 4:1998740-1998762 TCTCTAGGTTGAGGAAGTTCTGG - Intronic
971278853 4:25224407-25224429 TCCTTATGTTGAGGGAGTGCTGG + Intronic
972651754 4:41024631-41024653 TCCCTATGTTGAAGGAGGGCTGG - Intronic
974989277 4:69064290-69064312 TCCCTATGTTGAAGGAGTTTTGG - Intronic
975048777 4:69832919-69832941 TCTCTATATTGAGGGAGTGCTGG + Intronic
978533346 4:109736183-109736205 TCCTTATGTTGAGGGAGTGCTGG + Intergenic
980350988 4:131683103-131683125 TCCCTATGTTGAGGGAGCCCTGG - Intergenic
982819281 4:159926446-159926468 TCCTTATGTTGAGGGAGTGCTGG + Intergenic
984611139 4:181839554-181839576 TAGCCTTGTTGAGGGTGTGCAGG + Intergenic
985717342 5:1470017-1470039 TTGCTATGGAGAGGGTGTGCTGG + Intronic
987714867 5:21554904-21554926 TCCATGTGTTGAAGGAGTGCTGG + Intergenic
988214506 5:28253575-28253597 TTGCTGTGGTGAGGGAGAGCAGG - Intergenic
989309820 5:40002001-40002023 TCGCTATATTCAGGGAGTCTAGG + Intergenic
989758360 5:44983678-44983700 TTCTTATGTTCAGGGAGTGCTGG + Intergenic
992759559 5:79939455-79939477 TCCATATCTTGAGGGATTGCAGG - Intergenic
993516411 5:88841249-88841271 TCCCAAAGTTCAGGGAGTGCAGG - Intronic
1003213976 6:4091954-4091976 TCGCTATGTTGAGGGAGTGCTGG - Intronic
1003228102 6:4224561-4224583 TCCCTATGTTGAGGGAGTGCTGG - Intergenic
1003849658 6:10208872-10208894 TCTCTATGTTGAAGGAGAGTGGG - Intronic
1004603193 6:17170418-17170440 TCCCTGTGCTGAGGGAGTGAAGG + Intergenic
1005423301 6:25675158-25675180 TCCCTTTGTTGAGGGAGTGCTGG - Intronic
1006296907 6:33173804-33173826 TCAGGATGTTGAGGGAGAGCTGG + Intronic
1006888447 6:37402039-37402061 TCCCTATGTTGAGGGAGTGCTGG + Intergenic
1011504960 6:88031282-88031304 TCCTTATTTTGAGAGAGTGCTGG - Intergenic
1012463266 6:99487767-99487789 TCGCTCTGTCGCTGGAGTGCAGG - Intronic
1015806968 6:137119458-137119480 TCCCAAGGTTGAGGGAGTGCTGG - Intergenic
1017091954 6:150767129-150767151 TCTTTATTTTGAGGGAGTGTAGG + Intronic
1018838355 6:167501649-167501671 TCACTATGTTGAGGGAGAGAAGG + Intergenic
1020443956 7:8248710-8248732 TCGAGAGGTTGAGGGAGTGGTGG - Intronic
1022674064 7:32481929-32481951 TCCGTATGTTGAGGGAATGCTGG - Intergenic
1024423614 7:49199979-49200001 TCTGTATGTTGAGGGAGTGCTGG - Intergenic
1025788044 7:64661476-64661498 TTGCTAGGTTGAGGAAGTTCTGG - Intergenic
1032670497 7:134077950-134077972 TCCTTATGTTGAGGGAGTGCTGG + Intergenic
1032871495 7:135990905-135990927 TTTCCATGTTGATGGAGTGCAGG - Intergenic
1033106294 7:138528335-138528357 TCCCCATGTTGGGGGAGTGCTGG + Intronic
1033714805 7:143989221-143989243 TTCCTATGTTGAGGGAGTGCTGG - Intergenic
1034398847 7:150848184-150848206 TCGCTGTGCTGAGGAAGGGCAGG - Intronic
1039500578 8:38013574-38013596 TCCCTATGTTGAGGAAGTGCTGG + Intergenic
1039636955 8:39178066-39178088 TTGCTAGGTTGAGGAAGTTCTGG + Intronic
1040063497 8:43125013-43125035 TCCCTATGTTGAGGAAGTGCTGG + Intergenic
1041400856 8:57443210-57443232 TCCCTATGTTGCCAGAGTGCTGG + Intergenic
1041507350 8:58614285-58614307 TCCCTATGTTAAAGGAGTGCTGG - Intronic
1042929975 8:74003676-74003698 TCCCTATGTTGAGGGAGTGCTGG + Intronic
1046658656 8:116924768-116924790 TCCCTGTGTTGAGGGAGTGCTGG + Intergenic
1047398826 8:124528798-124528820 TCCTTATGTTGAGGGAGTGCTGG - Intronic
1053781720 9:41616612-41616634 TCCCTATGTTGAGGGAGCGCTGG + Intergenic
1054169668 9:61826766-61826788 TCCCTATGTTGAGGGAGCCCTGG + Intergenic
1054667870 9:67754049-67754071 TCCCTATGTTGAGGGAGCCCTGG - Intergenic
1055093364 9:72385466-72385488 TTAGTATGTTGAGGGAGTTCAGG - Intergenic
1056102650 9:83314572-83314594 TTGCTATCTTGAGGGGGTGGGGG - Intronic
1056578648 9:87874182-87874204 TCCTTATGTTGAGGGAGTGCTGG - Intergenic
1060097519 9:120805362-120805384 TCCTGATGTTGAGGGAGTGCTGG + Intergenic
1185983535 X:4805940-4805962 TCCCTATGTTGAGGGAGTGCTGG + Intergenic
1186087219 X:6003542-6003564 TCCCTATGTTGAGGGAGTGCTGG + Intronic
1189308909 X:40006534-40006556 TGGCGATCTTGAGGGTGTGCAGG - Intergenic
1190535046 X:51417646-51417668 TCCTTACGTTGAGGGAGTGCTGG + Intergenic
1191645369 X:63474910-63474932 TCCTTATGTTGAGGGAGTGCTGG - Intergenic
1193292847 X:79796796-79796818 TCCCTATGTTGAGGGAGTGCTGG - Intergenic
1197360224 X:125492637-125492659 TCCTTATGTTGAGAGAGTGCTGG - Intergenic
1199440077 X:147857822-147857844 TCCCAATGTTGAGGGAGACCCGG - Intergenic
1200415209 Y:2902819-2902841 TCCCTATGTTGAGGGAGTGCTGG - Intronic
1201147566 Y:11073206-11073228 TCTCCATGTTGAGGGCGTGGCGG - Intergenic
1201264905 Y:12196680-12196702 TCTGTATGCTGAGGGAGTGCTGG - Intergenic
1201428291 Y:13878603-13878625 TCCCTATATTGAGGGAGTGCTGG + Intergenic
1202237472 Y:22728550-22728572 TCCCTGCGTTGAGGGTGTGCTGG - Intergenic