ID: 1003213989

View in Genome Browser
Species Human (GRCh38)
Location 6:4092108-4092130
Sequence CCTTCATTACGGCGCCCAGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 62
Summary {0: 1, 1: 0, 2: 4, 3: 12, 4: 45}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1003213989_1003213995 1 Left 1003213989 6:4092108-4092130 CCACCTGGGCGCCGTAATGAAGG 0: 1
1: 0
2: 4
3: 12
4: 45
Right 1003213995 6:4092132-4092154 TATAGGATAAGCCCGTACCTGGG 0: 1
1: 1
2: 8
3: 19
4: 29
1003213989_1003213999 26 Left 1003213989 6:4092108-4092130 CCACCTGGGCGCCGTAATGAAGG 0: 1
1: 0
2: 4
3: 12
4: 45
Right 1003213999 6:4092157-4092179 AAGTCTAGATAACAGACATCTGG 0: 1
1: 4
2: 18
3: 44
4: 152
1003213989_1003213994 0 Left 1003213989 6:4092108-4092130 CCACCTGGGCGCCGTAATGAAGG 0: 1
1: 0
2: 4
3: 12
4: 45
Right 1003213994 6:4092131-4092153 TTATAGGATAAGCCCGTACCTGG No data
1003213989_1003214000 27 Left 1003213989 6:4092108-4092130 CCACCTGGGCGCCGTAATGAAGG 0: 1
1: 0
2: 4
3: 12
4: 45
Right 1003214000 6:4092158-4092180 AGTCTAGATAACAGACATCTGGG 0: 1
1: 3
2: 17
3: 47
4: 171

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1003213989 Original CRISPR CCTTCATTACGGCGCCCAGG TGG (reversed) Intronic
901310807 1:8268172-8268194 CCTTCATTAAGGAACCAAGGAGG + Intergenic
902207465 1:14879691-14879713 CCTTCATTCTGGAGCCCAGTTGG - Intronic
902377070 1:16034942-16034964 CCTTCATTACTTCACTCAGGTGG - Intergenic
902382244 1:16058201-16058223 CCTTCATTACTTCACTCAGGTGG - Exonic
902541135 1:17155698-17155720 CCTTCACTATGGCAGCCAGGTGG + Intergenic
914702836 1:150149991-150150013 CCTCCATCCCGGCGCCCACGCGG - Exonic
915054952 1:153119694-153119716 CCTTCACTACAGCGCCCAGGTGG + Intergenic
916527871 1:165628673-165628695 CCTTCACTATAGCGTCCAGGTGG + Intergenic
922945272 1:229508533-229508555 CCTTCTTGACTGCGCCTAGGTGG + Intergenic
924163026 1:241253398-241253420 CCTTCTTGAGGGCTCCCAGGTGG + Intronic
1062796622 10:349349-349371 CCTTCAGGACGGCGACCACGTGG - Exonic
1083830881 11:65232865-65232887 CCTTAATTTCGGCGCTGAGGTGG + Intergenic
1084007022 11:66328492-66328514 CCTTCATTGCTGCCACCAGGGGG - Intergenic
1084052021 11:66606165-66606187 TCTTCATTATGGCTCCAAGGAGG - Intergenic
1087871269 11:103295620-103295642 CCTTCACTATGGTGCCCAGGTGG - Intronic
1088501200 11:110484894-110484916 CCTTCAAGATGGAGCCCAGGTGG + Intergenic
1088686300 11:112287042-112287064 CCTTCATAACTCCTCCCAGGGGG + Intergenic
1090101060 11:123797295-123797317 CCTTCACTATGGTGCCCAGGTGG + Intergenic
1091583070 12:1800406-1800428 CCTTCTTGACGGCGACCAGGTGG - Exonic
1097138282 12:56878199-56878221 CCTTCACTATGGCACCCAGATGG + Intergenic
1101573837 12:105979691-105979713 CCTGCTTTAGAGCGCCCAGGTGG - Intergenic
1103380138 12:120487781-120487803 CCTTCACTATGGCGCCCAGGTGG + Intronic
1107914297 13:45133609-45133631 CCTTCACTATGGCGCCCAGGTGG - Intronic
1108337774 13:49463661-49463683 CCTTCACTGTGGTGCCCAGGTGG + Intronic
1109404130 13:61875433-61875455 CTTTCACTATGGTGCCCAGGTGG + Intergenic
1128520383 15:68370933-68370955 CCTTCCTGACAGCGCCAAGGTGG - Intronic
1129981754 15:79878547-79878569 CCTTCACTATGGTGCCCAGGTGG + Intronic
1140476214 16:75240362-75240384 CCTTCATTACGGTGGCACGGCGG - Intronic
1140644351 16:77013087-77013109 CCTTCATTTCAGCCCCCAGTTGG - Intergenic
1144208652 17:12996609-12996631 CCGTCATTACGGAGACCAGGTGG - Exonic
1149103932 17:52939032-52939054 CCTTCACTATGGCACCCAGGTGG + Intergenic
1155823533 18:30408870-30408892 CCTTCACTATGGCCCCCAGGTGG - Intergenic
1161294973 19:3514923-3514945 TCTTCATTCTGGGGCCCAGGGGG + Intronic
1161309672 19:3586670-3586692 CCTTCATCAAGGTGCCCGGGAGG + Exonic
1161373935 19:3929289-3929311 CATTCATTTCGGGGCACAGGGGG + Intergenic
1163367213 19:16882044-16882066 CCATCACTATGGCACCCAGGTGG - Intergenic
1164044071 19:21519398-21519420 CCTTCACTATGGTGCCTAGGTGG - Intronic
1165145319 19:33726741-33726763 CCTTCTTTATGGCGGTCAGGAGG - Intronic
926167740 2:10532023-10532045 CCTTCAGGACTGAGCCCAGGCGG + Intergenic
935880034 2:107556182-107556204 CCTTCGCTATGGCGCCCAGATGG - Intergenic
941999419 2:171631279-171631301 CCTCCACTATGGCGCCCAGATGG - Intergenic
942652389 2:178182282-178182304 CCTTAATTACTGCAGCCAGGGGG - Intergenic
949052877 2:241906555-241906577 CCTTCACTATGTTGCCCAGGTGG + Intergenic
1175730823 20:61352902-61352924 CCATCCTTGCGGCGCACAGGAGG + Intronic
969276024 4:6136394-6136416 CCTTCATTCCTGCTCCCAGTGGG - Intronic
972651772 4:41024796-41024818 CCTTCACTATGGCGCCCAGATGG - Intronic
978533337 4:109736021-109736043 CCTTCACTATGGCGTCCAGGTGG + Intergenic
1003213989 6:4092108-4092130 CCTTCATTACGGCGCCCAGGTGG - Intronic
1016691710 6:146945146-146945168 CCTTCATTAAGGCCCTCTGGCGG + Intergenic
1017975025 6:159349456-159349478 ACTTCATTCCGGTGCCCATGAGG + Intergenic
1029028177 7:97440107-97440129 CCTTCACTACGGTGCCTAGGTGG + Intergenic
1029662678 7:101973328-101973350 CGTTCATCACGGCTCCCAGAAGG + Intronic
1037889923 8:22618670-22618692 CCTTCAGTACAGCCGCCAGGAGG + Exonic
1041507362 8:58614444-58614466 CCTTCACTATGGCACCCAGGTGG - Intronic
1049526469 8:143129186-143129208 CCTGGAGGACGGCGCCCAGGAGG - Intergenic
1053382569 9:37660830-37660852 CATTCAGTACGGAGCCCAGAAGG + Intronic
1060097504 9:120805202-120805224 CTTTCACTATGGTGCCCAGGTGG + Intergenic
1061253944 9:129442796-129442818 CCTTCCCTACGGCGCTCATGAGG + Intergenic
1185983521 X:4805779-4805801 CCTTCACTATGTCGCCCAGGTGG + Intergenic
1189663546 X:43328504-43328526 CCTTCGCTACAGCGCCCAGATGG - Intergenic
1191645380 X:63475071-63475093 CCTTCACTATGGCGCCCAGGTGG - Intergenic
1201264915 Y:12196841-12196863 CCTTCACTATGGTGTCCAGGTGG - Intergenic