ID: 1003223471

View in Genome Browser
Species Human (GRCh38)
Location 6:4182914-4182936
Sequence TTAAAGAGTTTGTATTTGAT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1003223470_1003223471 -5 Left 1003223470 6:4182896-4182918 CCATAAATATATGCAATATTAAA No data
Right 1003223471 6:4182914-4182936 TTAAAGAGTTTGTATTTGATTGG No data
1003223468_1003223471 12 Left 1003223468 6:4182879-4182901 CCCAGGTTAATCTTTTTCCATAA No data
Right 1003223471 6:4182914-4182936 TTAAAGAGTTTGTATTTGATTGG No data
1003223469_1003223471 11 Left 1003223469 6:4182880-4182902 CCAGGTTAATCTTTTTCCATAAA No data
Right 1003223471 6:4182914-4182936 TTAAAGAGTTTGTATTTGATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1003223471 Original CRISPR TTAAAGAGTTTGTATTTGAT TGG Intergenic
No off target data available for this crispr